Gene SH2D2A Variant 1
DNA : 10.57 KbNT_079484
mRNA : 1606 bp NM_003975
CDS : 1170 bp NP_003966
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  136 bp
caggcagcagtaagggcttcctaacacctaaacacagagtgacacagataccccccaccg
ctataccaccgctatctacagctgcgtggcttccgggggtgggacaatcgtcttaaggct
ttccatgacgtgagtcctcgccagaactaaggctgtgggtaaggcgacatttcctgcccc
CGGGGCCAGGGTGAGAGGAGAGATGATGAGTTGCTGAGTGTGCACACCTTTCCGGAACAC
ATACACACACCCTGCTCTGGGATCCCTTGTGAGGCTGCCCTCATGGAGTTCCCCCTGGCC
CAGATATGTCCCCAAG
gtaagtgtgaagttgaaggatatgggtgggagggggcacaaagacccccatccccctgcc
ctccctcctgggcttgagctcccacttcagggatgaggggccccaccctaagccagagct
ggcaaagctgattggcagggtgaccacaaccctgcctggggctccatgcccactcatccc
EXON 2  89 bp
atgccgccttggctacttaacctcatgcctgagaaactcccctgctgcccttctgcgttt
ttcctgtcgttaagactgtcccagccctccagatcccctgagcctgggaggaggggtggg
aggcagagacagacatagttcctctctgagaaaccccggcagccctctttgtgctcacag
GGAGTCACGAAGCCCCCATCCCAACCTTCAGCACCTTCCAGATCACAGACATGACCCGCA
GGAGCTGCCAGAACCTGGGCTACACTGCG
gtgagtggaaacctggggcggcagcgtggtgcagctccctcatctctcccaccctcccat
ggggaaggacttgcagatggacaaaggccactccaagagaaggcaggaatgatccgggtc
tgccaacgggctggggcacagagagagagaacgaaaatgaggagtacctccttcatgcgc
EXON 3  185 bp
acagctggagctgaagaagggatttaagttagactttaggaaggactttctgggcaattg
taccctaaaatagacaggagaggctgggtatgaggaaaagaaggtggcaggtggatcaaa
gtcaggagaaggcccactcatcatgctgcttccccctccttgaactcttccctgatccag
GCATCTCCCCAGGCCCCGGAGGCTGCCTCCAACACAGGGAATGCTGAGAGGGCAGAGGAG
GTGCCTGGAGAAGGAAGCCTGTTCCTGCAGGCCGAGACCCGGGCTTGGTTCCAGAAGACC
CAGGCCCACTGGCTCCTGCAGCACGGGGCAGCCCCTGCCTGGTTCCATGGCTTCATCACC
CGGAG
gtgagtcatggaggaggaaattggcccagacaggggcagggcaagtcctgggtctgggtc
ctgccacctgccaggaatagatgaaggctcccacttctaccagtctggagtagatggagg
cgcccactccaggctcccactcccagagttttcctagcctttcactgaggcatctctcca
EXON 4  90 bp
aatccctgcagcgggagagcagcgcccacgtgctctctctccccatctccgccctagcct
ttctctagccgctccagcatgcttgcttgggggtaggggttcctcgtgagagccggggag
acagaggcgaggctggaagtgtcagagcagggttcggccccctctctccgtcacccacag
GGAGGCAGAGAGGCTGCTGGAGCCCAAGCCTCAGGGGTGCTACTTGGTGCGGTTCAGCGA
GAGCGCGGTGACCTTCGTGCTGACTTACAG
gtgaggggcgaggccccgcgccgggcgacacaaggcggggctcgggaggggcggggcttg
ggtctgatcccgtgaggagccgggctcttagctcattccccgggctgctgaaggtgggga
tcacgcctctcgctggtgaccctggccgaggagcgggagatagtctgatccctaacggcg
EXON 5  169 bp
cgaggccccgcgccgggcgacacaaggcggggctcgggaggggcggggcttgggtctgat
cccgtgaggagccgggctcttagctcattccccgggctgctgaaggtggggatcacgcct
ctcgctggtgaccctggccgaggagcgggagatagtctgatccctaacggcgccctccag
GAGCCGGACTTGCTGCCGCCACTTCCTGCTGGCCCAGCTCAGGGACGGGCGCCACGTGGT
GCTGGGCGAGGACAGCGCCCACGCGCGGCTGCAGGACCTGCTGCTGCACTACACCGCGCA
CCCGCTCAGCCCCTACGGGGAGACGCTCACCGAGCCCCTCGCCCGACAG
gtacgcgccccagaccctgaccagagagcccagggtctcgggccagcgcccctcccgctc
agagcccaggcgcaggacgcggcaccaggcactttctcatcccgaaacaccactcgggca
tgcctcccttacccaggcatcttcatcttcatgggagggtggcaggcccttcgagaaata
EXON 6  147 bp
ctgggtctccctgccgtcaccaccccctcttcctcatccagggaacccagcccaggccaa
atttctgtgctcctcccccttcccccatcctccacttagactggattattttgtcctcct
gatcacctcccccaccccaacgctccaccgagtgcctcagacctccttctttcccagcag
ACTCCTGAGCCTGCAGGACTTTCCCTGAGGACCGAAGAATCAAACTTTGGAAGCAAAAGC
CAGGACCCAAACCCCCAGTACAGCCCAATCATCAAACAGGGGCAAGCCCCAGTCCCGATG
CAGAAAGAGGGGGCCGGGGAGAAGGAG
gtattgggctgcaggggctgagggagtgggaggacaggcctgcgagggggtgcaggcagc
ggggaggaggaggggcctagcgggggcagaggctcaggctgggagttaggctggggcttt
aaccctgcctccctcaccccactcctccctggcctcaccttctctcccagccctcccagc
EXON 7  288 bp
ggagaaggaggtattgggctgcaggggctgagggagtgggaggacaggcctgcgaggggg
tgcaggcagcggggaggaggaggggcctagcgggggcagaggctcaggctgggagttagg
ctggggctttaaccctgcctccctcaccccactcctccctggcctcaccttctctcccag
CCCTCCCAGCTGCTCAGGCCCAAGCCTCCCATCCCCGCCAAACCTCAGCTGCCCCCAGAA
GTCTACACAATCCCTGTTCCACGACACCGCCCGGCCCCACGCCCCAAGCCCTCCAATCCT
ATCTACAATGAGCCTGATGAACCCATAGCTTTCTATGCCATGGGCCGGGGCAGCCCTGGG
GAAGCCCCCAGCAACATCTATGTGGAAGTGGAAGATGAGGGCCTACCCGCCACCCTTGGG
CACCCTGTCCTACGGAAGAGCTGGTCCAGGCCTGTCCCAGGAGGCCAG
gtaaatgggtatgcagggaaaggtaggtgcaagaaggtctccctgcaggtagatggggga
aggtgaagaaggtgttcagagtggatgcctggggcagggtaaggggcagaggtgtgaggt
gatgtgggaagaacagaatgatccaggcaccagcctcccttctccaggcccagaggctgc
EXON 8  171 bp
agcccagtgcctggcacagagcaggtgctcaggagatgtttgttgaattaatgaatgaga
ggagtttagataccctctctggaagccaaagtctgttcagatcagatgtcttgagactgc
aagtacacctaggaggcagagggtagagggtgtgacctagaactgtccttctctctgcag
AATACAGGTGGCTCCCAGCTGCATTCTGAGAACTCTGTGATTGGGCAAGGCCCTCCCCTG
CCCCACCAGCCCCCACCCGCCTGGAGACACACCCTCCCCCACAATCTTTCTAGACAGGTG
CTTCAGGACAGAGGACAGGCATGGCTTCCCCTTGGGCCTCCTCAGTAGGCG
gtaagtctgagcttggtgaggataacttggagcatcaggtccagagaccttcacacacac
ctggcacacttctcaagaaatgtggatggaataaaccataggtgttcaaagctggaaagg
agctcagccatcatctattgcaaggatggcaaagaggtgtcatcttgcatgccaactcca
EXON 9  331 bp
tgattccctgtttagtgctttgttccttaccacacatccacaaactcaagtccataggaa
acatcagagatttcctcaaacaggaagtctggccactttccagagttctactgcatggag
gcctgggtgcttcattggtcccctcctgtggatcctggcttaactctgtccccctgacag
GTCTGGCCTGACCCCCAACAAAGAAGCCTGGAGGTCAGAGAAGCAAATGCGGAGCCTGCT
CCCTCCTAAGAAGATCCCAAGAATCCAATGGCTCAGTCCTTGGTGATCTAAGACAGCAAA
GAAGTGTGCAAGGAGGGCCCTGTTAGCTCCCACTGTCCTGGTTTCTCCTCCTGGAGTCTA
ATTTCCTTGGCCCTCTGAGCCTTTTGAGTCTGGGCCCTGGTCCAATGCTGCTGTTGTCTG
AGGAATGGTTTGGTGAGAACAGATGTTAGAACTTGTTTGTTGATTCTTGTCTGGCTAATA
AATCATCACCAACTGCCTTCTCCTACAGGGA
ttcaagtcctccaggctccttctgtttctgtctctgactttctctctctcatactgtgga
aggcaaggagttgaactgccactgcagtgagggtggaggggcttgaggattgacagacac
caaggccaggaatacagacctctgcaaactattccttctttagctgggatgggttgagta