Gene SELE Variant 1
DNA : 11.40 KbNT_004668
mRNA : 3833 bp NM_000450
CDS : 1833 bp NP_000441
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  68 bp
ttttaagcatcgtggatattcccgggaaagtttttggatgccattggggatttcctcttt
actggatgtggacaatatcctcctattattcacaggaagcaatccctcctataaaagggc
ctcagccgaagtagtgttcagctgttcttggctgacttcacatcaaaactcctatactga
CCTGAGACAGAGGCAGCAGTGATACCCACCTGAGAGATCCTGTGTTTGAACAACTGCTTC
CCAAAACG
gtaagtgcagaacgctttataagggcagcctcgggccatgaaacacagatatgcaaaagg
ccttctaataaaaaccacatctgtacaagctcttattgtattgtagctaaaacctgtctt
ttctctttgacctaaataatgaaagtcttaaaatttgtttatttatttgattaaactctg
EXON 2  85 bp
cctaaataatgaaagtcttaaaatttgtttatttatttgattaaactctgaaataaagat
tattgcactagtgtcctttgcccaaaatcttaggatgctgccttaaacatcatggtagaa
taatgtaactagctacccacgatttccttctttaattcattttgtgttttatctccccag
GAAAGTATTTCAAGCCTAAACCTTTGGGTGAAAAGAACTCTTGAAGTCATGATTGCTTCA
CAGTTTCTCTCAGCTCTCACTTTGG
gtaagtcagtgccattagaccaagatttctcattctcgcactatagatatttcagactga
aatatccttgcttgtctggggctgtcctgcacaggatatctggcagcatccttgacctct
acctgcaatgtgttcttccctgggcttggggtcatttactttacctcttggtgtctccct
EXON 3  384 bp
caaaagagataaacaataagtcgctgtttcttcatacgtacttcttacttttgaaaagat
gagaaaagtctgggccatgtcacaaacattgccaaaaataagacaataaaaagcacagtt
gtcagagttaaaccacaacagtaccaaactctaccatttcttttctttttctcccactag
TGCTTCTCATTAAAGAGAGTGGAGCCTGGTCTTACAACACCTCCACGGAAGCTATGACTT
ATGATGAGGCCAGTGCTTATTGTCAGCAAAGGTACACACACCTGGTTGCAATTCAAAACA
AAGAAGAGATTGAGTACCTAAACTCCATATTGAGCTATTCACCAAGTTATTACTGGATTG
GAATCAGAAAAGTCAACAATGTGTGGGTCTGGGTAGGAACCCAGAAACCTCTGACAGAAG
AAGCCAAGAACTGGGCTCCAGGTGAACCCAACAATAGGCAAAAAGATGAGGACTGCGTGG
AGATCTACATCAAGAGAGAAAAAGATGTGGGCATGTGGAATGATGAGAGGTGCAGCAAGA
AGAAGCTTGCCCTATGCTACACAG
gtagggagtttgcggcagcagtgggaggtagtttcagtgtgtgggcatcttggcaaattt
acagcatgcaaaaactgctctctattgtggtcattttatgttccaaaagattctgtttaa
ctgctaaagtttctctcttttgctgttttgtgtgaatgtgggcaagaatatgtggatatg
EXON 4  108 bp
aggtttaggataggtgggcctgaaactcagatttggaactttgtaaaacacttcagttaa
agtctatggcactctgtaggactgctgatgtctctgttgcacactgttgattctaaaatc
aaaggcactcagtataagcacagtaatagtcctcctcatcatgctttgtattttccgtag
CTGCCTGTACCAATACATCCTGCAGTGGCCACGGTGAATGTGTAGAGACCATCAATAATT
ACACTTGCAAGTGTGACCCTGGCTTCAGTGGACTCAAGTGTGAGCAAA
gtaagtctggttcttgcctctttcttcacttgagatggtagcaccatctcacgtcctagc
tggcattagagtcaggtctgcatgccttcccttccctggtgcagatggtgtcatatggtg
atcgtgagctgagactatgaagtcagaccctgctgggtttgagtcctagattcaccagtt
EXON 5  186 bp
tcagcattttcttgaataaaagaaaaggggtagaattacagtcaattttacaaattccat
tagaaattttataaatttttaaactaaaaaaaaaaaaaaccaaactgtagttctagtttc
cagtgttcttatctgttaaaggtgagagatgagcagaactgatttgggtttctttttcag
TTGTGAACTGTACAGCCCTGGAATCCCCTGAGCATGGAAGCCTGGTTTGCAGTCACCCAC
TGGGAAACTTCAGCTACAATTCTTCCTGCTCTATCAGCTGTGATAGGGGTTACCTGCCAA
GCAGCATGGAGACCATGCAGTGTATGTCCTCTGGAGAATGGAGTGCTCCTATTCCAGCCT
GCAATG
gtaaatccctctgagaatgcacagaacgttctgtaactcatccctcattgcttctgtttt
ttgattcaacttacattttcaaaacttcagggaaagttttttttttgtttttgtttttaa
tacaatttgttctctcagccaatgtatattgccaacccagtacctgcttgggttgagaga
EXON 6  186 bp
gaatatccatgaaaaagaataaaagcttttattctggctgtgcatgtccctaagaattga
cataggactttgggatctaccctttgaaggcagcttcctcactctgttaggcacccagct
caataggaagtgaaaagatcattcttctgtaaaattcatggtgctctttaaaatcctcag
TGGTTGAGTGTGATGCTGTGACAAATCCAGCCAATGGGTTCGTGGAATGTTTCCAAAACC
CTGGAAGCTTCCCATGGAACACAACCTGTACATTTGACTGTGAAGAAGGATTTGAACTAA
TGGGAGCCCAGAGCCTTCAGTGTACCTCATCTGGGAATTGGGACAACGAGAAGCCAACGT
GTAAAG
gtagagttgttccacatggagacttactgtgaacattctttctctcaacccatactggaa
atgggcaagctaattctaggccgtgctaatatcaatgcgtatatttgttacagctgtgac
atgcagggccgtccgccagcctcagaatggctctgtgaggtgcagccattcccctgctgg
EXON 7  189 bp
atgggagcccagagccttcagtgtacctcatctgggaattgggacaacgagaagccaacg
tgtaaaggtagagttgttccacatggagacttactgtgaacattctttctctcaacccat
actggaaatgggcaagctaattctaggccgtgctaatatcaatgcgtatatttgttacag
CTGTGACATGCAGGGCCGTCCGCCAGCCTCAGAATGGCTCTGTGAGGTGCAGCCATTCCC
CTGCTGGAGAGTTCACCTTCAAATCATCCTGCAACTTCACCTGTGAGGAAGGCTTCATGT
TGCAGGGACCAGCCCAGGTTGAATGCACCACTCAAGGGCAGTGGACACAGCAAATCCCAG
TTTGTGAAG
gtaagcttgagatccttcgatttatactttcttaaagaacaaccatcttcaaacttggac
agtgaaaaaaaaaaccaatacccactttaactatagaaatcagatttgatgagcaaccct
cgtatctttgagattcatttaaaagaactaatgtttggccagggaaaggatcatatgtgt
EXON 8  189 bp
catgatcagtgagggggctgaaattcaaagaaaacacagccatcttcccatttgtccagg
gaattataaagaatcttcagttctccaagtgttgcttgaatgaactgggttcactcaaca
aacgccaagtactctctagttccactgcaatattttctgaccatcattttgatgtctcag
CTTTCCAGTGCACAGCCTTGTCCAACCCCGAGCGAGGCTACATGAATTGTCTTCCTAGTG
CTTCTGGCAGTTTCCGTTATGGGTCCAGCTGTGAGTTCTCCTGTGAGCAGGGTTTTGTGT
TGAAGGGATCCAAAAGGCTCCAATGTGGCCCCACAGGGGAGTGGGACAACGAGAAGCCCA
CATGTGAAG
gtacagtctttgtttttattttattttaagataaaaagaactattgaagagcttgggaac
ttggttaccttgggaaacgtattgctggagatgcaaacaaacttctaaagtgctctctcg
tgtgttccagctgtgagatgcgatgctgtccaccagcccccgaagggtttggtgaggtgt
EXON 9  189 bp
ccaatgtggccccacaggggagtgggacaacgagaagcccacatgtgaaggtacagtctt
tgtttttattttattttaagataaaaagaactattgaagagcttgggaacttggttacct
tgggaaacgtattgctggagatgcaaacaaacttctaaagtgctctctcgtgtgttccag
CTGTGAGATGCGATGCTGTCCACCAGCCCCCGAAGGGTTTGGTGAGGTGTGCTCATTCCC
CTATTGGAGAATTCACCTACAAGTCCTCTTGTGCCTTCAGCTGTGAGGAGGGATTTGAAT
TACATGGATCAACTCAACTTGAGTGCACATCTCAGGGACAATGGACAGAAGAGGTTCCTT
CCTGCCAAG
gtagaattgagtgcagacttttttagggtacaggtcaaatacttcataaagtttctgaac
ctagattgccccaaaggggtttggtcctaatttcctacatgctgaaaactaagtagcgct
tacactttacattcattgttgacttttaagcaagttttggaagttttccagtagattttt
EXON 10  177 bp
gtcaaatacttcataaagtttctgaacctagattgccccaaaggggtttggtcctaattt
cctacatgctgaaaactaagtagcgcttacactttacattcattgttgacttttaagcaa
gttttggaagttttccagtagatttttctgaaactctgcctgtgtacctaacatttgcag
TGGTAAAATGTTCAAGCCTGGCAGTTCCGGGAAAGATCAACATGAGCTGCAGTGGGGAGC
CCGTGTTTGGCACTGTGTGCAAGTTCGCCTGTCCTGAAGGATGGACGCTCAATGGCTCTG
CAGCTCGGACATGTGGAGCCACAGGACACTGGTCTGGCCTGCTACCTACCTGTGAAG
gtgatgcattgattgatggtggttgtctggtgattaaaaagaaaaagggggagctatctt
gttacagtaatcaactattcattatatccaaaccagaaagttcgcccaggttgacaagtt
gtgaatattaagttgtatggggatagagaaaaaacagaagttgcatgttgatggaaaggg
EXON 11  108 bp
aaaggtggcttggagcagatctcaaaggcctgtaatgccacatctctgcttcttgtatta
aactagatagctcttctgctcctagtaatgaatgtacagaaaaaaggccaaagggacagg
acggagagactttaacatcaattcttcctcatgacctttcttcgtctcttacttccttag
CTCCCACTGAGTCCAACATTCCCTTGGTAGCTGGACTTTCTGCTGCTGGACTCTCCCTCC
TGACATTAGCACCATTTCTCCTCTGGCTTCGGAAATGCTTACGGAAAG
gtgaggaagtttatgaatgtacttcaaaaatgtttttgaaaatacatttctttctcattg
ataagtcatggtcttgcttactgatttaaacaataattagaatctggataaaatgcagta
taattaagcagaagtattaagaaaagagttagtagtacaactcagtgtgggaagtgtttc
EXON 12  22 bp
tgtgcactttgcattttaccctagatgccacagagccatgcttgtgctctgattattaca
gaggccctgaagcatcgagtttgcaacacttgatgaattaagtcatattgtatctggatt
taatatatccttaaaagtcatttagtctgaattaatggttgtttgtcttttcttttgcag
CAAAGAAATTTGTTCCTGCCAG
gtaagttgcattcttatacaaagcatgccattgaacattccacatatttttctctcttca
tgttggaagacagtgctttacctagtgttctcatgtattccacagcagctgccaaagcct
tgaatcagatggaagctaccaaaagccttcttacatcctttaagttcaaaagaatcaggt
EXON 13  73 bp
tccttaaaagtcatttagtctgaattaatggttgtttgtcttttcttttgcagcaaagaa
atttgttcctgccaggtaagttgcattcttatacaaagcatgccattgaacattccacat
atttttctctcttcatgttggaagacagtgctttacctagtgttctcatgtattccacag
CAGCTGCCAAAGCCTTGAATCAGATGGAAGCTACCAAAAGCCTTCTTACATCCTTTAAGT
TCAAAAGAATCAG
gtaagacttgtaaatcacaaatggttatgagagaggtatcttctctacatgctctgtttc
tccttgaaccctccaaacttgccaatatcttagggagggagcaggggagaaatcatcacc
tgggtattgttctggaaagttgctttattttttgtagaaggagaggaaagaaacggatct
EXON 14  1869 bp
tctgtaggttttgacagaggtataatatgtagacatcatcactgtcctaactgaatagaa
ttcgatgttcctacatggtctatcctagtgagagtgtctgtgttagaaggtacattttgt
tgtcatgatcagtatgcagaatattaagtgttctgatgacatgcatgtttatatttacag
AAACAGGTGCATCTGGGGAACTAGAGGGATACACTGAAGTTAACAGAGACAGATAACTCT
CCTCGGGTCTCTGGCCCTTCTTGCCTACTATGCCAGATGCCTTTATGGCTGAAACCGCAA
CACCCATCACCACTTCAATAGATCAAAGTCCAGCAGGCAAGGACGGCCTTCAACTGAAAA
GACTCAGTGTTCCCTTTCCTACTCTCAGGATCAAGAAAGTGTTGGCTAATGAAGGGAAAG
GATATTTTCTTCCAAGCAAAGGTGAAGAGACCAAGACTCTGAAATCTCAGAATTCCTTTT
CTAACTCTCCCTTGCTCGCTGTAAAATCTTGGCACAGAAACACAATATTTTGTGGCTTTC
TTTCTTTTGCCCTTCACAGTGTTTCGACAGCTGATTACACAGTTGCTGTCATAAGAATGA
ATAATAATTATCCAGAGTTTAGAGGAAAAAAATGACTAAAAATATTATAACTTAAAAAAA
TGACAGATGTTGAATGCCCACAGGCAAATGCATGGAGGGTTGTTAATGGTGCAAATCCTA
CTGAATGCTCTGTGCGAGGGTTACTATGCACAATTTAATCACTTTCATCCCTATGGGATT
CAGTGCTTCTTAAAGAGTTCTTAAGGATTGTGATATTTTTACTTGCATTGAATATATTAT
AATCTTCCATACTTCTTCATTCAATACAAGTGTGGTAGGGACTTAAAAAACTTGTAAATG
CTGTCAACTATGATATGGTAAAAGTTACTTATTCTAGATTACCCCCTCATTGTTTATTAA
CAAATTATGTTACATCTGTTTTAAATTTATTTCAAAAAGGGAAACTATTGTCCCCTAGCA
AGGCATGATGTTAACCAGAATAAAGTTCTGAGTGTTTTTACTACAGTTGTTTTTTGAAAA
CATGGTAGAATTGGAGAGTAAAAACTGAATGGAAGGTTTGTATATTGTCAGATATTTTTT
CAGAAATATGTGGTTTCCACGATGAAAAACTTCCATGAGGCCAAACGTTTTGAACTAATA
AAAGCATAAATGCAAACACACAAAGGTATAATTTTATGAATGTCTTTGTTGGAAAAGAAT
ACAGAAAGATGGATGTGCTTTGCATTCCTACAAAGATGTTTGTCAGATATGATATGTAAA
CATAATTCTTGTATATTATGGAAGATTTTAAATTCACAATAGAAACTCACCATGTAAAAG
AGTCATCTGGTAGATTTTTAACGAATGAAGATGTCTAATAGTTATTCCCTATTTGTTTTC
TTCTGTATGTTAGGGTGCTCTGGAAGAGAGGAATGCCTGTGTGAGCAAGCATTTATGTTT
ATTTATAAGCAGATTTAACAATTCCAAAGGAATCTCCAGTTTTCAGTTGATCACTGGCAA
TGAAAAATTCTCAGTCAGTAATTGCCAAAGCTGCTCTAGCCTTGAGGAGTGTGAGAATCA
AAACTCTCCTACACTTCCATTAACTTAGCATGTGTTGAAAAAAAAGTTTCAGAGAAGTTC
TGGCTGAACACTGGCAACAACAAAGCCAACAGTCAAAACAGAGATGTGATAAGGATCAGA
ACAGCAGAGGTTCTTTTAAAGGGGCAGAAAAACTCTGGGAAATAAGAGAGAACAACTACT
GTGATCAGGCTATGTATGGAATACAGTGTTATTTTCTTTGAAATTGTTTAAGTGTTGTAA
ATATTTATGTAAACTGCATTAGAAATTAGCTGTGTGAAATACCAGTGTGGTTTGTGTTTG
AGTTTTATTGAGAATTTTAAATTATAACTTAAAATATTTTATAATTTTTAAAGTATATAT
TTATTTAAGCTTATGTCAGACCTATTTGACATAACACTATAAAGGTTGACAATAAATGTG
CTTATGTTT
atctctgtgttaagtctctttcttagaaattttatttagataaaactcactttccataaa
acgcaccctttaaaaatgtatgtgattgtacagctatcaccattgtttaactccagaaga
tttctatcaccctgataaaacattatttctcagtgtgtctgtgagagtatttccaaagag