Gene S100A1 Variant 1
DNA : 3.64 KbNT_079484
mRNA : 594 bp NM_006271
CDS : 285 bp NP_006262
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  100 bp
ccctgcaccatccactgctgcctggagagaaaggaacggggcaagcaaggctgggaaaga
gacaagggccgcctgttccagcccaggagacagagggcgcctctgtctgctcctggcccc
ttgccccacagggtgttcgtctgtgaaggggtggagtcggtgggggggtcagcgggggag
GGACTGTTGAAGACAGGTCTCCACACACAGCTCCAGCAGCCACATTTGCAACCTTGGCCA
TCTGTCCAGAACCTGCTCCCACCTCAGGCCCAGGCCAACC
gtgagtaccctgccccactgggctagtccctggcctgccagcttcagggagaggggtctt
cagaagggctccaagaggctggggaccatagcactgtggagcactgaggatctgggagga
gtcagtcagggtgagggcagtttgggatttgggggagacagggtttggaaggtggtgatg
EXON 2  154 bp
ttaggtctcttggggtttccctcacattgtaaaatctcagggaaagatcaattgcagtag
ggctctaatcccacagctatttgagctgtcagccagggccagtcctgagggttcccctca
cctagaccccaggtactccgggcctggtcctcagctcacttccatgatgggggtgggtag
GTGCACTGCTGCAATGGGCTCTGAGCTGGAGACGGCGATGGAGACCCTCATCAACGTGTT
CCACGCCCACTCGGGCAAAGAGGGGGACAAGTACAAGCTGAGCAAGAAGGAGCTGAAAGA
GCTGCTGCAGACGGAGCTCTCTGGCTTCCTGGAT
gtgagcatagagtggtggagtgggagtggagtgggtgaaggttgggggaatggggtggac
acccccttgctatctccccaccccacctccagctcagcctagcctctttctttcctttcc
caggcttctctcctgggtttttccaggctcccctactcctcctgggtcaagtcaaaatgc
EXON 3  340 bp
gagcttatgctgtaggcaacagaagccctcaagacctttgaggaggcctagaagagtccc
ataattcaatgcagttcctctcgctcatctttgcctcctgctcctcaaccacccccttgc
ctctgactcagtgctgtacccttccctatacacctccctcttcctctcctcccaccacag
GCCCAGAAGGATGTGGATGCTGTGGACAAGGTGATGAAGGAGCTAGACGAGAATGGAGAC
GGGGAGGTGGACTTCCAGGAGTATGTGGTGCTTGTGGCTGCTCTCACAGTGGCCTGTAAC
AATTTCTTCTGGGAGAACAGTTGAGCAGACAGCCACATTGGGCAGCGCCCTTCCTCTCCA
CCCTCCCAGACCTGCCTCTTCCCCCTGCTTCCACCTCACCCCACTTATCCCTCTCCATAA
CCCCACCCTTGCCCACCCCACCCCCACCCCCACCAAGGGCGCAAGAGTAGCGGTCCAAGC
CTGCAACTCATCTTTCATTAAAGGCTTCTCTCTCACCAGC
catccgatgtctgtctcctctgggatctggaagtgggtggagacgtgaagactgttcact
ctcaactccccttatttggggaagtgtcttatttagaaagaggtcaaggtgcattacatc
ttcctacttgaggaatgctcaaggtccagaaatgtgggggttcaaggttccagttggaag