Gene RERE Variant 1
DNA : 465.07 KbNT_021937
mRNA : 8026 bp NM_012102
CDS : 4701 bp NP_036234
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  306 bp
cccacagacgctcgcgagcaaccctccgcgctccggagcctcctcagcctcccgcacacc
ccgagacgctcgccccgctgggcctcggtccccgcctcctcccccgtccttttcccctct
ctcgctccccacattgtctctgcctcattttctctcctagttgaggattaaaaaaaaaaa
AAAATCACCATCATCCTCAGGGAGCCCCCTCGCCCTCGGAAAACAAAACCAGACATGATC
CTGGGCTCCTGCTTCTGAAAGATCTGCCCGACCGAGGAGGAGGGAGCCTAGGTTCAAGTC
GCAGGAAAGGTCACGGCAGGGAAGCCCCCTCAGCCCCTCCGCGTCGCCTCCCCGCGGGCC
GCCCCTCTCGGCCCTGCGCCCCGCGGCCCCGCAGCCTCCGCGCGGCCTCCCGCCCCATCC
CCGCCACTTTCCCCGGAGCTGGGCCGCGAACACCTCACTATTGATGGTGTAGCGCTTTAG
GGGAAG
gtaagtgtccaacttgcccgcgccgggtcgtgtgctttcttttttggcccctcgtcctgg
tggtcagagagggtcggccgtgaaagcagtcactcgcccggggggaggcaggaagaaaag
gctggggtcgaagccgaagtcgaggggagtcgggcgagggcagggcacttctttggtcct
EXON 2  185 bp
ctgggggaggtgttagggaattgaatgttgctaaagcaccaaagagagaggagtttgact
attttgagcttgtctgtgacacctgttttgtttggaaaatgctaatgaaactagttggca
gagctgcatttttgaagttgtttcatttagtcacagtgatagtcatctgtcttcttttag
GAGGTGATTGTCTAGGAGTAACTGTATGTGCGCTCAGCACCGGGTCACAACCACCGTGGG
ATCCACTTACAGAGAAGATTTGTGGAGAGCTTCAGCCTGTTTATGGTGTTACTGAGAAAG
GAATTGTGGCCATTTGATATAATTCTGGATGGAAGACCTCTTATTTGTATTACATTGAAT
TAGAG
gtcagtatttgaaattttctccttgagtggctattataagaggatcccgtaagaattgat
tactgtgaaattagccaactacatagtgtatttcaaagataaggtaaactgttggacttg
tgattacctggtttctggtatgaattactgaacttatgtttgtttttatgtgcatagata
EXON 3  469 bp
caaaccatttgctgagaccaaaaactgtagtttttaaattttaacacttaatttttctcc
tgtggcttgtgcgaagtttttaggtgtaaagcatgaataagtaagagattcatttaacaa
aacattattttaggaaacaaatatgaaaaagcgttaaaaccattcttttttctctcctag
CATTTTTGAAACGTTGGGGTTGTTGGAGTGGTTGGATTTTCCCTGGAATTGAGTGAGAAA
TTCAGAAGACTGAAGCCCAGGCTTACTGTCTACCTTTCACGGAGGCCTAGCCGTGAGAGG
ACAGAAGAAGGCACGTGGCGAATCATGACAGCGGACAAAGACAAAGACAAAGACAAAGAG
AAGGACCGGGACCGAGACCGGGACCGAGAGAGAGAGAAAAGAGACAAAGCAAGAGAGAGT
GAGAATTCAAGGCCACGCCGGAGCTGTACCTTGGAAGGAGGAGCCAAAAATTATGCTGAG
AGTGATCACAGTGAAGACGAGGACAATGACAACAATAGTGCCACCGCAGAGGAGTCCACG
AAGAAGAATAAGAAGAAACCACCGAAAAAAAAGTCTCGTTATGAAAGGACAGATACCGGT
GAGATAACATCCTACATCACTGAAGATGATGTGGTCTACAGACCAGGAG
gtaaggagccttacgtttgggtcttgccaatgtttacagtgggggaatgatcttggcatt
atggtgaaataaatacgctttgtacactttaaggaaggcttggaatctagaagagtagga
aacttaatttggtaaacatgtgacccacttttggtcagttaggttcacccacttcttgct
EXON 4  71 bp
ccaaagggcagttttcctttagcctaaagatatttgcaatttaatatcatcttttggaaa
aaatttacaataaaagatatgtgctttgtcatttatttatttatgcagtggctttatggg
ccctgtctttgttccttaaaggtaaatgccattgttttaaaatttctttttcttttaaag
ACTGTGTGTATATCGAGAGTCGGAGGCCAAACACACCGTATTTCATCTGTAGCATTCAAG
ACTTCAAACTG
gtaagcgtttttaatgtgctgttcactctgctctgtattctctctttttccagttccatt
ggctatctcttattgttcctccatcgctgttgacgtggttaccagttcaccttttgagtg
ctaactgcctcgtggcagtagcactgaaatgagggttactagttccatcttttcagcttt
EXON 5  126 bp
aggtaacagctttgattaatgcaaaaaggttaactttagtggtagaacaaattatctgag
gtttcagaggtcatctgctaaagagtttttgcagataccgacttgtgtgctgcgtgcccc
taataaccagggcatgatggggcgttgggcacgttaacttaaaactgttttcttttttag
GTCCACAACTCCCAGGCCTGTTGCAGATCTCCAACTCCTGCTTTGTGTGACCCCCCAGCA
TGCTCTCTGCCGGTGGCATCACAGCCACCACAGCATCTTTCTGAAGCCGGGAGAGGGCCT
GTAGGG
gtaaggagaatcccgtttttaaaagctatcagtattttatatcccatagggtataaaata
ggaatattacctccctccccagagccccttttaaaatgtgctgtattatatgtgttttta
aaggagtaacaagtacatgcacagaggaagcaaaatacgggacttgccttacccctctag
EXON 6  106 bp
tttttaaaaaacaaaacttgacctcataactgacttatgtattgttgtggtcctgatggt
aattgtgtctctccctatctacgtgtccacccgtttacaggggcttttggtcatgggtat
gatatgcacttgtggccacctgaaatcctgttcctaatgctgttagattttccttttcag
AGTAAGAGGGACCATCTCCTCATGAACGTCAAATGGTACTACCGTCAATCTGAGGTTCCA
GATTCTGTGTATCAGCATTTGGTTCAGGATCGACATAATGAAAATG
gtaaatatgtccttgtggtttgatttgtgtgtttcttagctttgggcaaagttctttcta
aagacatttcattaaatgaagataactttttgaaaaatggattttggagtgttggtaggc
cttatgcttgatgattcacattggctaccagttagtcacgtgaggtgggtctgtccctct
EXON 7  97 bp
acattctgttattgttattcttgcaatttatgattcctcttctctattttgcatacttaa
cgatgctaaccaggcccggttatttagtgggtggtaaacgtgaaagaaaagttttacaaa
ttttttttacttgttttgggaaactcagttttaatgtcgtcttaattaattttttgacag
ACTCTGGAAGAGAACTTGTCATTACAGACCCAGTTATCAAGAACCGAGAGCTCTTCATTT
CTGATTACGTTGACACTTACCATGCTGCTGCCCTTAG
gtaagtactggagacgtgctcttccatgtgaaggaggagtcactgagtgcaggaggtgga
gagtaatttctcctgatcttttagtagtcactgtattaatcagactcctcttttggcctc
agtgaacatgccagtgtccgctctggattgttgagattgcagaggttctccgtgtcttca
EXON 8  105 bp
cacaggtgtacagtgaagcagtcatgaaacagctgaataggtgaaataaagtgtggtgtt
tgtagccgattctccatgcacatggacttagttcagtgcttcctccacccttccccctcc
agttttggttagcaaaagcagttgagggtattactaattatttttttctctttttcccag
AGGGAAGTGTAACATCTCCCATTTTTCTGACATATTTGCTGCTAGAGAGTTTAAAGCCCG
AGTGGATTCATTTTTCTACATATTAGGATATAACCCTGAGACAAG
gtaagtgagtcacttgtgtccattcattgagaactcttttccttttctcatttgtgtgtg
tgtgtatgtgtgtgtgtgtgtagtttatgcttctggacatacactagtaacatacttaaa
aaaaatgactccagagtccttcagtaaacttctttgggaggagttgtaattaatgtcttt
EXON 9  49 bp
agaggtgcatgtgtggtggtgggtggtgtatgtatacagaacattagaagtagtggggac
gttaattcttcctcagtttttcctcatttatttgaagagaattactttttttgaaaaatg
tgtgaatgtttatgtcaaaactgtattgcgctaacttaatctgctctatttctgttccag
GAGGCTGAACAGTACCCAGGGGGAGATTCGTGTCGGTCCTAGTCATCAG
gtgaagttcattttcatagcttccttaataggtttttgtttcttattactctgctggcac
tttattctgttgcgcagcatcttagaatgtggttattgctatcgggaattttttataaat
acagaggttttttttccaccctcctcagatcaccacatacatttaccatctcccattttt
EXON 10  125 bp
atgatcctgacatgtgaaataggtcagtttaaatgactcatggttttgttgttatttttc
tgctgtccaaggaaagagtctcagtaaaacattgtatatgttcctaaagactgcttattg
agatagctctttataattaatacatgccttgattgtgacttactcatccctgtcttacag
GCCAAACTTCCAGATCTGCAACCATTTCCTTCTCCAGATGGTGATACAGTGACCCAACAT
GAGGAACTGGTCTGGATGCCTGGAGTTAACGACTGTGACCTCCTTATGTACTTGAGGGCA
GCAAG
gtaataggaatctacccccatcctgctttctgaattagaccatctgaactgattataggc
agtaaactttgcatttcccctgagattttatttctatattgggcgttctctgactttaag
tttggttacaccctctgtaatcgggaccctggctcttcttaccagagaaaaatagtttga
EXON 11  100 bp
actccatctcaaaagaaaaaaaaaaaaaaataggagcagaggcagagctgggaactggtt
catcatgcgtgtagtaatggaatttgttctgggctggaaatgtcctctgaaaattgaagg
tctaagtctctgtcctgatattactatgtactaataaaggaaaaaccttttcttctgaag
GAGCATGGCGGCATTTGCAGGAATGTGTGATGGAGGCTCTACAGAGGACGGCTGTGTCGC
AGCCTCTCGGGATGACACCACTCTGAATGCACTGAACACA
gtaagtcttttgaagtcaccctgagtgggaagacacttctttttcccctgaactggctgt
agggaatgtgtgatgagtgcggagcatgaagtcgcctgtagactcaggagtgagttgtgg
tcttggctgttgggtgccatgggggctccaggccagtgatgtggcacctgcaggttcatt
EXON 12  99 bp
gggttgggatagggtggtcttggatgagaacaaattcctgcgcctactgaaatgatggag
tctcagtgcccctttcctgactcttctgtgggagatagtcaatgaggagcttgccttgga
tcgattgtgtcctgtctgttatttggtgcagttagctaactataattgttgttgttttag
CTGCATGAAAGCGGTTACGATGCTGGCAAAGCCCTGCAGCGCCTGGTGAAGAAGCCTGTG
CCCAAGCTCATCGAGAAGTGCTGGACCGAGGACGAAGTG
gtgagcaggaaccagcatttgccttgtgctctggggcatcgggccaccggcgtctcagtg
tgtgacctccctgctgctcagggaaagcagaagcttcagtcatgcagaatggctgtccgt
ggcagcgccaggcaggaggatggggcccttcagccccttaattgtacagaaagacttgat
EXON 13  81 bp
gggcctgccctggccagtgggtcccagctgagctgctgacatactctccgagcctcggca
gtattccctagccgagactttttttgtggttgttattctgctgattgtagatatctttgc
tttgctgacatcctgttttgtttttggtttttacatcccatttgtttctttttatcacag
AAACGCTTCGTTAAGGGACTCAGGCAGTACGGGAAGAACTTCTTCAGAATTAGAAAGGAG
CTGCTTCCCAATAAGGAAACA
gtgagtacaattggactttatgtaacttgattttttcctctttgctcctgctgcctctcc
acatttgatcttatgaaatggtttcctttaaccctgcgctgtgctcagactcgggctggc
ctccagaattctctccgttttactcccttgacttttaatttgagttcataatttttagat
EXON 14  163 bp
cagctcagtggctgtttcttgggcaagcccagttcctctcccaactccaggagcgactgg
tctttattctcatctctggcacagctgttaaacacccagctttccactgtggcagagagg
gtgcgtggggcacggaaaagccccaggccctcccccacagtcagcccttctcttctgcag
GGGGAGCTGATCACCTTCTATTACTATTGGAAGAAGACCCCCGAAGCAGCCAGCTCCCGA
GCCCATCGTAGGCACCGCAGGCAGGCCGTGTTCAGGAGGATTAAGACTCGCACCGCGTCC
ACACCCGTCAACACACCCTCCAGACCCCCGTCCAGTGAATTCT
gtgagtaggggtcttggcatcacagtgggcggaggggagactgttcacgggcagcctgtc
ccactctgggcccgtaggagctgatggctccgggaagcatgagggggtgtgcacccgtgc
tccagtgcatgtgtgaagcctgacctaaacatagaccgatggtgggggcggggagcagga
EXON 15  93 bp
tggtcctttgcagacactgtcctacctcagcctgtgcacccagccgctctgactggtggc
cagaacctgcagtaggccagaggtcacaggtgttcccccctcccccccaccccaccggcc
cagccttggctgagcatgatggtgtctcccccacccccactatgtgcctgccacgcccag
TGGACCTAAGTTCAGCCAGTGAAGATGACTTCGACAGTGAGGACAGTGAGCAGGAGCTGA
AGGGGTACGCCTGCCGCCACTGCTTCACCACCA
gtaagtggcctcgtcacgctcctggggcggggcgggggcacaagcacttccatgttctga
acatttcatgcatccagctggaaacctgccagggacagtacttgatttgacatttgcatt
gtgcttcgggattcgagaaagttagaaatgtttagtttactttactcctctgcttggcag
EXON 16  200 bp
aaaccctctcctggccttgggggagcagggcagcactagccctggggtgttggggcccag
ggctgcatggtgctggtggcatcaggtttgggtagagcccacagaagggcccctctgccc
agacatccccagggagagggatggtttccaaggttggcccccaccacttccctcacacag
CCTCCAAAGATTGGCACCACGGAGGCCGGGAGAACATCCTGCTTTGCACCGACTGTCGCA
TCCACTTCAAGAAATACGGTGAGCTCCCGCCCATTGAGAAGCCCGTGGACCCGCCACCGT
TTATGTTCAAACCCGTCAAGGAAGAGGATGATGGGCTCAGTGGGAAGCATAGCATGAGGA
CACGGCGGAGTCGGGGCTCG
gtgagtcccctggggccatggggctcctggcaacttcttcagtttcctgggatgtgtggg
ggcttgagcctcccagggggaggaagcgaaagtcttgtttaccagacaaagtcctggagg
ggagctgctttgcccgaggcggtagcttgcctgtgggctgggaagagttctctgttctct
EXON 17  162 bp
ctccacaccgaccttcatgcagccagggacaggcagggcggcctgttgtttgccaaggtc
tgggatttgctgagaggctgatagggtgtgccttcaggcttctgcctgtgggttgggctc
aggtgggtccacatggggactgggaatctggtgtcaccagtcttcggtttgggtgggcag
ATGTCGACACTACGCAGTGGTCGGAAGAAGCAGCCAGCCAGCCCTGATGGTCGCACCTCA
CCCATCAATGAAGACATCCGCTCCAGCGGCCGGAACTCCCCCAGCGCTGCCAGTACCTCC
AGCAATGACAGTAAAGCAGAGACAGTGAAGAAGTCGGCCAAG
gtcaggtgctggggggatagtagggcctactctgtccctccctcacattaaaactggttt
gctggtattcgtgatcagctccctcagacacgaggatgcagctcattcatggagcctgtc
tggacaccagcattgtcctggcctaggggctgcagaccgaaggctgggggcctagagaag
EXON 18  114 bp
attcccacccccagatacgtgttccttcttggccccagttgacccttctagagctttttg
ctcctggagatggaactcagaatgagggagcaaagtgtctgcaaaccgtcatttccttgc
tgaggctgatgggatggtctcccttggcctgattgctccttgtgggcttttcccctgcag
AAGGTGAAGGAGGAAGCCTCTTCCCCTCTTAAGAGTAACAAACGCCAGCGGGAGAAGGTG
GCCTCTGATACGGAGGAGGCTGACAGGACCAGCTCCAAGAAGACAAAAACGCAG
gtgaggtttgctgctgagccttgctgagtaaagctaatgcttcttcagaagcccccagcc
ggggttctccctagttggtggccgtgccctgtctcctagggtggggctggagtggccttt
gacactggctgggtcagggcacgacctgtggtcccggagccaagcttgctgcttcatctg
EXON 19  1379 bp
ctcctagggtggggctggagtggcctttgacactggctgggtcagggcacgacctgtggt
cccggagccaagcttgctgcttcatctgcacaaacattactgtgtgtccggcactggtgg
tgcagagcagacagggctctgccctcctgggacttccatccttcccttctctgactccag
GAGATCAGCAGGCCCAACTCGCCATCTGAAGGTGAGGGAGAGAGTTCAGACAGTCGCAGC
GTCAACGATGAGGGTAGCAGTGACCCCAAAGACATCGACCAGGACAATCGCAGCACGTCC
CCGAGCATCCCCAGCCCCCAGGACAATGAGAGTGACTCGGACTCGTCAGCCCAGCAGCAG
ATGCTGCAGGCCCAGCCCCCAGCCTTGCAGGCTCCCACTGGGGTCACCCCAGCTCCCTCC
TCAGCTCCTCCAGGGACCCCTCAGCTGCCCACGCCAGGGCCCACGCCCTCTGCCACTGCA
GTTCCCCCACAGGGCTCCCCCACGGCCTCCCAGGCCCCTAACCAGCCACAGGCTCCCACA
GCGCCTGTTCCCCACACCCACATCCAACAGGCACCGGCCTTGCACCCCCAGCGGCCGCCC
TCACCGCATCCCCCGCCGCATCCCTCGCCACATCCCCCGCTGCAGCCTCTGACTGGGTCG
GCGGGCCAGCCTTCTGCACCCTCTCATGCCCAGCCCCCACTGCACGGTCAGGGCCCACCC
GGCCCTCACAGCCTGCAGGCTGGGCCCCTGCTGCAGCACCCAGGCCCCCCACAGCCCTTT
GGCCTCCCTCCCCAGGCCTCCCAAGGCCAGGCCCCTCTGGGGACCTCCCCAGCAGCAGCG
TACCCTCACACCTCCCTGCAGCTGCCAGCCTCTCAGTCAGCGCTGCAGTCCCAACAGCCT
CCACGGGAGCAGCCCCTGCCACCAGCGCCCTTGGCCATGCCCCACATCAAGCCCCCGCCT
ACCACTCCCATCCCCCAGCTGCCGGCGCCACAGGCCCACAAGCACCCTCCCCACCTCTCG
GGGCCCTCACCCTTCTCCATGAATGCCAACCTGCCTCCCCCTCCAGCCCTGAAGCCCCTG
AGCTCCCTGTCCACACATCACCCCCCGTCGGCTCACCCCCCACCCCTGCAACTCATGCCT
CAGAGCCAGCCATTGCCCTCCTCGCCCGCCCAGCCCCCCGGGCTGACCCAGAGCCAGAAC
CTGCCCCCGCCCCCTGCCTCCCACCCCCCTACAGGCCTCCACCAGGTGGCCCCCCAACCC
CCGTTTGCTCAGCACCCCTTTGTCCCTGGAGGCCCTCCTCCCATCACCCCTCCGACCTGC
CCCTCCACCTCTACCCCACCGGCGGGACCTGGCACCTCGGCCCAGCCACCCTGCTCTGGT
GCGGCGGCTTCAGGAGGCAGCATAGCGGGGGGGTCGTCCTGCCCACTCCCCACCGTCCAG
ATCAAGGAGGAGGCTCTGGACGACGCTGAGGAGCCTGAGAGCCCCCCTCCCCCACCAAGG
AGCCCGTCCCCGGAGCCCACTGTGGTGGACACCCCCAGTCACGCCAGCCAGTCAGCTAG
gtacgcttcctagggctccaggacgggtcaggcacaggtgggctggtgggggcaagttct
ggtgggagggagggccggggtgggtctcggcaggagctcccagcaagatctgtggctttt
ctcaggttctacaaacacctggaccggggctacaactcgtgtgcccggacagacctgtac
EXON 20  223 bp
cgtccccggagcccactgtggtggacacccccagtcacgccagccagtcagctaggtacg
cttcctagggctccaggacgggtcaggcacaggtgggctggtgggggcaagttctggtgg
gagggagggccggggtgggtctcggcaggagctcccagcaagatctgtggcttttctcag
GTTCTACAAACACCTGGACCGGGGCTACAACTCGTGTGCCCGGACAGACCTGTACTTCAT
GCCTCTGGCCGGGTCCAAGCTGGCCAAGAAGAGGGAGGAGGCCATTGAGAAGGCCAAGCG
CGAGGCTGAGCAGAAAGCCCGAGAGGAGCGAGAGCGGGAGAAGGAGAAGGAGAAGGAGCG
GGAGCGGGAGCGAGAGCGGGAGCGCGAGGCAGAGCGGGCGGCT
gtgagtccagggttggcgaggtgtgacggggggcgctggtccatcctgcgcctgggagcc
acgctgggccaccgagctctgcccttggctgcctgactcggcctcctggcagctagaggg
ttgggtgctatttacaccctgtctccacacctctgacgggtgctgcacatccgaagctgc
EXON 21  721 bp
ccctgtggggcctggactgcatcctggtgtcaggccaaggcagggccgggtctccgtgga
gggaccaggttggcctgtcagagcaggccaggagcaggaccaggcccacctccgcagtgt
ggaccaagcggagaccccaggcgctcgggggacccctcacgctttcttttccttctgcag
AAGGCGTCCAGCTCAGCGCATGAAGGTCGCCTCAGTGACCCACAGCTCAGTGGTCCTGGC
CACATGCGGCCATCCTTCGAGCCACCACCAACCACCATTGCTGCTGTGCCCCCCTACATC
GGGCCCGACACACCTGCCCTTCGGACTCTGAGCGAGTACGCCCGGCCCCACGTCATGTCG
CCCACCAACCGCAACCACCCCTTCTACATGCCCCTTAACCCCACGGACCCCCTGCTGGCC
TACCACATGCCTGGCCTCTACAACGTCGACCCCACCATCCGCGAGCGGGAGCTCCGGGAG
CGGGAGATCCGAGAGCGGGAGATCCGAGAGCGGGAGCTGCGGGAGAGGATGAAGCCGGGC
TTCGAGGTGAAGCCCCCAGAGCTGGACCCCCTGCACCCAGCCGCCAACCCCATGGAGCAC
TTTGCCCGGCACAGCGCCCTCACCATCCCCCCGACCGCCGGGCCCCACCCTTTTGCTTCT
TTCCACCCGGGCCTGAACCCCTTGGAGAGGGAGAGACTGGCCCTGGCGGGCCCCCAGCTG
CGGCCCGAGATGAGCTACCCTGACAGACTGGCAGCCGAGCGTATCCACGCAGAGCGCATG
GCATCGCTGACCAGCGATCCCCTGGCCCGACTGCAGATGTTCAACGTGACTCCGCACCAT
CACCAGCACTCTCACATTCACTCCCACCTCCACCTCCACCAGCAGGACCCCCTCCACCAA
G
gtgcgtgccccagcgtggcaggtgggacagaggcacggggaggggtgcagagcctgatga
gtgacagtcaccatccaggagcggaaactgttcttttctgaacagatccctcatccctgg
cagatcttagaagagctcagcatccactaccgtcatggttttgctgtatcgcagtctctc
EXON 22  147 bp
cttgctgaaggtggaggcagccactttggggcagggccacctgtagccaggtggtgcatc
cagccctggtgaccaggagccatcctgggtgaggaggaagtcatcggtcattccagccaa
gggggacaaacattgaagagctgcacaccgcctccatctggcgttttgtcctttccttag
GTTCAGCAGGCCCCGTTCACCCGCTGGTCGACCCCCTGACTGCCGGTCCCCACCTGGCTC
GCTTCCCCTACCCGCCTGGCACTCTCCCCAACCCTCTGCTTGGACAGCCCCCACACGAGC
ACGAGATGCTTCGCCACCCAGTTTTCG
gtaagacttcccctccaggaggggcggggaggccgtgtgagggttgggttggggtctggt
ctgctgtcttcattcattactcattcattcattcatgcattgagcaggtgggttcgctcc
ccctgcatgcagggggtccgtgggggaacaagcctcctgccctctgggggctgtctgggg
EXON 23  181 bp
cacctcctgcctccccagaggctctgccctctggctgtctgcagagtctgggaggggctg
gctcctgtgtccgaactggcacctctcctgtgctctttgccgtttgctgtgcctgtgccg
ccctggtcttggccagtcctctggctatttctgtagcgcaggttgttttgtgttcggcag
GCACCCCCTACCCCCGTGACCTGCCTGGGGCCATCCCACCCCCCATGTCAGCAGCCCACC
AGCTGCAGGCCATGCATGCCCAGTCGGCCGAGCTGCAGAGACTGGCCATGGAGCAGCAGT
GGCTGCATGGACACCCCCACATGCATGGTGGCCACCTACCAAGTCAGGAAGATTATTACA
G
gtgaggtggggtgctgggagggagtggaggggttatctgagcccaggctcccaacctccc
cgtgtgcccagggccaggctcctccccctctgcctgctgggccctggaggggacattgtg
gaaccatggtgatgggagaaacagaggaagggaggtgttgggagggtaggtcagctacac
EXON 24  2724 bp
tggaaccatggtgatgggagaaacagaggaagggaggtgttgggagggtaggtcagctac
acaggaggctgcgggcttggggttggattgcctggctgttgtctttggggttgcctccag
cctgcgtgactgcctgcctaggcctgagactaaatacgctttcctgttttgtctttccag
TCGACTGAAGAAAGAAGGTGACAAGCAGTTATAAGTTATTTATTTGTTAACGCTGGCTGT
GGAAACCCCAGTTCTTGGGGGGAGAAACAGGACTTTTTACATAAAATAGGAGCTGCAAAA
GCAAAAAGAATATCTTCTAAAGATTTCTTTATATATTTAAAAACCCACAACTAAAAATGT
ATCCACATAGTAGTGTTCGTTTGTCGAGAGGATTTCCTGAGACTGGTTTGGATCTCCCTG
CATGACAGTCCCCCAGAAACTTAGTGAGTCCTGGACTGGACTGAACATCCAGAAAGCTTC
CCTGCAATCTTGGGGTTTGGCTTTAGTTTTCTTTTCCTTGATTTCTCAGTAGGTGCTAGA
ATCCAGTTCACACCCTTCACTGTGCGTGCAGACACACTGACACACTCCGCCACGAGTGCT
CCAGAGCCCACGAGGCTTGCAGATCGGGGGCATAGGAATTTGGAATCCAAGAGCTATAAT
TTTTAAAAAAAAAAATCTTTTATTTTAATACATTGTAGGAAATCTTCATAATTGGAGAAA
GTTCTGCAGCATGGCTTTTTACGTCTGTAAATAAATAATTTTAGAACAGCCTTTTTTTCT
TCCATAAACTACTATTGTGATCTATTTTTTCCAGCCATGTCACTAATTGTGAATTCCTAC
CAACTATTGACAGAATACAGAGTTGATTTTTTAATAAAAAGTTATATATAATTATCCCTT
TAATTAAAGGGAGCAAAGGGGCGTTCCACATGGACAGAGGCTTGGACCGAGGCCTGGTCA
CAGCAGCGAGCATCCAGGGTTTGCAGGGACGATGTTACAGACTCTGTTTTCTGCCTGGCG
TTTCACTTGTGTCTGCTCCTAGCCTGTGCTCTGCCAGCAGCACAGACATCTGCTCCATCA
GACCTCTTCCATTTTGCACAGGGAGTGCAGGAGGTGAATGTTCACTTTCTGTTCTCCAGT
GTCACTGTTCTGTTTCCACGGGATGGAAAGCGCATGGGCCTGTGTCCATTGTAGATTTCC
TTCTAGATTTCTGTGTACACACACTTGATTGTTCTGGATGAATGTCTTTTTTAATACTCC
GAAAATTTCATCATCTAAGAAAATGATTCCATACAAATAACTCAGCACACAAGTGACCCA
GGACATATGCCTGCCAAAGGGATGTGTTAGAAGGCTGCCTTCTCATGCGCATTGTCACTT
GGATCTTGTGGTGAGGACGGCCCCATCTTTCTTGCCACAGATTGAGGCCACTTTTGAGCA
AGGGAGATCCTGGAGTTAAGACAGGTGTTGGGGGCAGCCTGTATTTTACCCTAGGGGCAG
GTCTGCATGGTGACCCCACATTGCACTGGTAAACCATTTGAGTCCCACTCTTCATCCTGG
AAGTGGGAACTGGAGTCCCACCCACAGTGCATTCAGAAAGCATGCTGTGTGGGGGCTGCT
TCTCAGGAGGCCAGGCCCTTCTGAGCGGAACCGTCCTGGAGAGAGCCTGCCCTCGTTTCC
AGGCTGCAGCCGTAACGCACTTTCTCCCAGGCTGAGGGCGGGTGTTCTGGGGTGTCTGCC
CTCTGTCGGCCCTGCTTCCTGCCAGGACGTGGCCTCTTCCGATCCTTTTCTCTCAGACAC
TGGAGGTCTCTTCTGCCATTGTGCTGGTCCCATCCCAAGAATTGTAGGACAGAGACCACA
CTGGGTCGGCGGACACAAAGTCCATCCAGGACCCAGGCCGCAGAGGGAGCAGGAAGAGAT
GCTGATAGTTTGATCTAGAAACCAGCAGCTACTGGCTCAAATTCAGGTTCTGGCGTCAAA
TAGCGACATTTCCAGTTTCTCTTAAAAACCGTGTTTGGTTTCAGTTGGGATAGGCTTGTT
TTGTCTGTTGAAAATGTTTCTAGTTTTTTTTCTTTCATTTTTCTCTCATTCCATTTCTGC
CTTAACTTTAGTTTGTTCACAGGGAGGCAAAGCTGACATGAACCTTTTGTCGTGGGACTT
CAGGCCACATTGGCTTGAAGGCATTCGTTTCCTTCTGGGGTGGGGACAGGCCCTCATGGC
AGGCTTGTTCCCGTGGCTCTGAGCGAGGCCTCTTCCTGCTGGGCTCCCAGACTCCTGCAT
CCAGGCCCCCACCTTCTCGGCTTCTGGTTTTTCTTTCTTTTTGGTAGAACACAACATCTA
CCATTCAGTTAAACCTTCTTTATCTCCTCCTTTGGCATCCATTTTTCCAAAGAAGAGTCG
AGTCCTCTGAGGTCTGTGCTTGAAAGCCGTCCGAAGGCATTCTTGTTAGCTTTGCTTTTC
TCCCCATATCCCAAGGCGAAGCGCTGAGATTCTTCCATCTAAAAAACCCTCGACCCGAAA
CCCTCACCAGATAAACTACAGTTTGTTTAGGAGGCCCTGACCTTCATGGTGTCTTTGAAG
CCCAACCACTCGGTTTCCTTCGGATTTTCCTCCCTTTGTTCGGGGTTTGGTTTGGCTCCT
CTGTGTGTGTCCGTATCTTGTTCGGTGTCCTCGAGGTTGAGCTTCACTCCACTGCGGCAG
AGGCAGCGTGCACACTCGGATTTGCTACGTTTCTATATATCTTGAAGCTAAATGTATATA
TGAGTAGTTTGCCATGAGATAACACAGTGTAAACAGTAGACACCCAGAAATCGTGACTTC
TGTGTTCTCTCCATTTGAGTATTTTGTAATTTTTTTGAAATATTTGTGGACATAAATAAA
ACCAAGCTACACTACAACCCTTGG
gtgtctcccgtgcactgtctcattcctggagagtgggcggggatcctggctgttacccca
ggtggggaagggacagagggagagtcggctgttccctgctgctcgggaccctgtttgcat
cccagagtggcttccagaaacatcctctgtctgggaagaggctttccctggtgagggtgc