Gene PRKAB2 Variant 1
DNA : 12.58 KbNT_034400
mRNA : 819 bp NM_005399
CDS : 819 bp NP_005390
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  156 bp
aggcgttcccgcaggccaggagggagagggctccagggctcggcttccctggggcgggga
atcccttgccctgtcccgaggcgcaggggcggggccggggggcgcccctgacgcggcggc
tgaggtgttcccagcccggtgtcgttccccgcggtaggtggtccccgacgagctgcagcc
ATGGGAAACACCACCAGCGACCGGGTGTCCGGGGAGCGCCACGGCGCCAAGGCTGCACGC
TCCGAGGGCGCAGGCGGCCATGCCCCGGGGAAGGAGCACAAGATCATGGTGGGGAGTACG
GACGACCCCAGCGTGTTCAGCCTCCCTGACTCCAAG
gtaagcgtcccatgcccgcagttggtgtcagtactgcagcgggttgatttctgggctcct
cttccctttcttggttcttttctaccgcgccgaaccgggctatggttttttgaattaaag
ggatttatcggggacagaggtgttggatgataattcctcttgaagtgccgcctcaaaata
EXON 2  167 bp
tttttggtcctagatgagttctttttctataatttgttcaaactctgatttagttgctaa
ttttggggtttatatccttagccaaagcctagcacccttctctatcctagggaggagagt
gacctttttagaattcttgggtcacagtttattctagggatgacctactccttcttacag
CTCCCTGGGGACAAAGAGTTTGTATCATGGCAGCAGGATTTGGAGGACTCCGTAAAGCCC
ACACAGCAGGCCCGGCCCACTGTTATCCGCTGGTCTGAAGGAGGCAAGGAGGTCTTCATC
TCTGGGTCCTTCAACAATTGGAGCACCAAGATTCCACTGATTAAGAG
gtgacaagtgtcttggttgaatctaagggtccaggaatagagacctgatttcttttctca
gaagagagacccagctggacttttctccacctactaaggactgtctctagaacatgccct
tttctgcggccacttagtatatctgtgggatttttttttaacctcatagtgagtcagaga
EXON 3  94 bp
tacatgtccaagatgatacagaaaaggagaatgggtttatacgttgttttttacaccagg
ggatacaatggcttaggaatctgggaaattattcatatgatactatgattgccacttgtt
ttttagattcagtcttctaaaaggaacttggcctgtttgcctttcttttttcttctgtag
CCATAATGACTTTGTTGCCATCCTGGACCTCCCTGAGGGAGAGCACCAATACAAGTTCTT
TGTGGATGGACAGTGGGTTCATGATCCATCAGAG
gtaaggccttgatctccaagggtaaccattgacttagcagtctcattttagctgtcattt
ctgtcaagactgatgggcagctgctcccctacactggaggatttctctcttgataaaacg
tggaggtgctgagaacaatcgtgtaaattttagtaaaagaggaaggttggatggaagaga
EXON 4  121 bp
ttagctgtcatttctgtcaagactgatgggcagctgctcccctacactggaggatttctc
tcttgataaaacgtggaggtgctgagaacaatcgtgtaaattttagtaaaagaggaaggt
tggatggaagagatggatttgaaagagagattcaataattttttctattcactgtttcag
CCTGTGGTTACCAGTCAGCTTGGCACAATTAACAATTTGATCCATGTCAAGAAATCTGAT
TTTGAGGTGTTCGATGCTTTAAAGTTAGATTCTATGGAAAGTTCTGAGACATCTTGTAGA
G
gtaattttgtattatttactctctcttgctgtgtctttcttgtagttccttcctaaaagt
tgtttatgtgtgtatatacatatagagggagagagagagcagggggttggggggaggaga
gagagagacagagatttttctcctgtaaacatttaggtctcttatttgcagcaaacacaa
EXON 5  134 bp
atgtccaggggactcagatttttcctctggttaccttacagctgtagatcccacaggtca
caagtttgtgatccaggacttctaccatatttaatgttagctgccatgtattgatagctt
tttccatgcattcttgctaattctccaactctttctcatatttgtataaatatctttcag
ACCTTTCCAGCTCACCCCCAGGGCCTTATGGTCAAGAAATGTATGCGTTTCGATCTGAGG
AAAGATTCAAATCCCCACCCATCCTTCCTCCTCATCTACTTCAAGTTATTCTTAACAAAG
ACACTAATATTTCT
gtgagtatcctgagtattactggggcatctgggggtgtctaggaccatttggaccaaagt
tcagtaatcctagaggttaggattactacagaggtgtgttgagattataagtcatacaca
taccaataacattacagatttcctttttccagtggtgagtcacagctttttcaggtactg
EXON 6  69 bp
aattttctgtaataggattgtattattgatacatactagagtgggtgcattattgaaaag
agatagcgcattctagtttaaatttctcaaagagctctgaggaagagtaagctgtttggt
ttgtctgtgcattaatttcatttagtaatttttttagtaatttttttctctttctcttag
TGTGACCCAGCCTTACTCCCTGAGCCCAACCATGTTATGCTGAACCATCTCTATGCATTG
TCCATTAAG
gtaagtggtggccctggctcttcacagagctccctggaatgagaggtcaagggtaacata
cgttctcagtggttactttctctgctatttcattgaagctgaagctggcagtaatgatca
aattatagaagaactctcttttttttaactactaggttgtttgttttaaaatctcagtct
EXON 7  78 bp
ccaaggccacaagtagaatgatgataggagtcagaattggaactaaaacttatttgacct
cctgctcttatatcaaactatctctgttaaaagtgagtgactgtgaaggactgatgactg
ggaagagctacctactgtctgaagtaatgaattagctgcgtatgtttcttttccttgcag
GACAGTGTGATGGTCCTTAGCGCAACCCATCGCTACAAGAAGAAGTATGTTACTACTCTG
CTATACAAGCCCATTTGA
agggatcccttcttgcctctaaggattcaggagaagcatctcccttgcatttctggactg
aaccagtcttacctgagactggaaggctgatttgctttgaggctgatatgtgtgtttcag
agcctctgagtaggatgctctgcttttgcatttgattgcagatgagagctttatgagttc