Gene PRDX6 Variant 1
DNA : 11.46 KbNT_004487
mRNA : 1670 bp NM_004905
CDS : 675 bp NP_004896
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  146 bp
agcccggcccggcccagccccgccccgcgcccagccccgccccgccccgcgcccagccca
gcccccgcggcccggcccccagcggccggcctcccgcggccccgcccccgccgccccagt
ccccgcccctcgcgccttcgtttattcctccgcgcgctgggacaggctgcttcttcgcca
GAACCAACCGGTTGCTTGCTGTCCCAGCGGCGCCCCCTCATCACCGTCGCCATGCCCGGA
GGTCTGCTTCTCGGGGACGTGGCTCCCAACTTTGAGGCCAATACCACCGTCGGCCGCATC
CGTTTCCACGACTTTCTGGGAGACTC
gtaagtggccaccgcgtagccctgtcctggcctcggttgcgccggactcggaggtgcctt
ccctgtttcttctccctgccgtcctcccggccgctcagccccctgcgccgccctcgcctt
cccccgcactggttccggcgcgcgccaggccgtgtggcctctgctcagcgtcggctgcgc
EXON 2  157 bp
ctctggaggtaagtagattgaaaagcactcctcaacagaaaagcttaaaagtaaatatca
tcataagcattcatttaaaaaagaaagcctgtttttgatccagaagttgtgacttttcat
tctctgtgatgttggtgataactcttaattcaattgtgaccttgtttttcttcctttcag
ATGGGGCATTCTCTTCTCCCACCCTCGGGACTTTACCCCAGTGTGCACCACAGAGCTTGG
CAGAGCTGCAAAGCTGGCACCAGAATTTGCCAAGAGGAATGTTAAGTTGATTGCCCTTTC
AATAGACAGTGTTGAGGACCATCTTGCCTGGAGCAAG
gttagtatcaattggcatgtgctttgagcctgagattataggtcaagttataaattatgg
agtacttggttttgaggttaaggtacaagtaagccttaggttcaaagttcactaattatt
tgaaaatttcagttgaaccacacagtgatcacattgctaaatccattggtcagtcaattc
EXON 3  147 bp
cctggcaataattggaatgaagagtgttcatctactcactttttaaaattaaaattgctt
aaagaaaattactgtgatttggtcctctttcctgtcttgcaaggtgatggctgttaactg
atgaaattcagagcatgtgttgggtttagattcctctttccccttttacttgtgtttcag
GATATCAATGCTTACAATTGTGAAGAGCCCACAGAAAAGTTACCTTTTCCCATCATCGAT
GATAGGAATCGGGAGCTTGCCATCCTGTTGGGCATGCTGGATCCAGCAGAGAAGGATGAA
AAGGGCATGCCTGTGACAGCTCGTGTG
gtaggtcatacaaattcattttgtagttagcttaactgatcaggctgtatgtccgtgtaa
atgctggtaccagctagaggagataggggaatatctacgattatgaaataactgtgtatt
ggcgacaatatcactgattatctgtaatgctgatgcaattttcagctaaattttccaact
EXON 4  147 bp
gggagaagaaaattatctgtattccagccatccacattagcagttggtgtatccttctag
atgctttgtttttgtcttgtttttatacccttgaacattattaatgactgcagagctttc
taagtggctttaataacactcaaagaactcttcctatttatgcccctctgtgctttacag
GTGTTTGTTTTTGGTCCTGATAAGAAGCTGAAGCTGTCTATCCTCTACCCAGCTACCACT
GGCAGGAACTTTGATGAGATTCTCAGGGTAGTCATCTCTCTCCAGCTGACAGCAGAAAAA
AGGGTTGCCACCCCAGTTGATTGGAAG
gtaaagatgtttttaaaaagcagtttctctacttgcctgaagggccagtctctaaatggc
caacttcaaggtctgtgttacctgtttctagcacgcaagtacactgggaggatttttcct
catggctgagttcaagatttgctgaaaggcccttttcaaggtctttataacaccttttat
EXON 5  1073 bp
tgctttcctgccaaaagtgccaaagatcaacttggaaaacaaaatcctcacagaggggag
agtaaagaacacttgattagtctcattagcacctgtagctacttttctaaagttaattcc
tgaaggccttgaagcttcactatgagattgaatttcaccattctcaatgtctttcaatag
GATGGGGATAGTGTGATGGTCCTTCCAACCATCCCTGAAGAAGAAGCCAAAAAACTTTTC
CCGAAAGGAGTCTTCACCAAAGAGCTCCCATCTGGCAAGAAATACCTCCGCTACACACCC
CAGCCTTAAGTCTCTTGGAGAAGCTGGTGCTGTGAGCCAGAGGATGTCAGCTGCCAATTG
TGTTTTCCTGCAGCAATTCCATAAACACATCCTGGTGTCATCACAGCCAAGGTTTTTAGG
TTGCTATACCAATGGCTTATTAAATGAAAATGGCACTAAAAGTTTCTTGAGATTCTTTAT
ACTCTCTGCCTTCAGCAATCAATTCCATTCATACATCAGCACTCTGCTGGTTCTGTTTGA
AATATGTTCTGTATTTAAAACTCAAATCTTGTTGGATCTCTGCAGGGCTTGTGACCAATG
AAGTCATATTTGTTGATGGTTGACAAAGCTTGCTTCACTCCATCAGAGAATGACTATCAA
TTTTTTTTTAACTGTCCTATCACGTCCTCTCCTGTCACCCATTTTGAAGAGTGGCAGAAC
TTGAAGTTCAACTTCCTCTGTAAATATCCAAGTATAAAGCCCAGGAACTTCTAGAATAAC
CCAGATGCGCTTTAATTTTTTTTAATATGTTTTGATCACAGAACTTCTAGAATAACCCAG
ATGCTCTTTCATATTCTTTTAATACATCTTGATCACAGCTGGGGGAAAAAAAGCTTTTTA
ATTCTATACCTTCCTAGTAGATAAGTGAAGAGCAGGGAAAGAGACCTTTAAATATTTTGC
TATAAAAAAATTTGTGATAAGTTTCTATCAAAATGGGGAGATTGCAGAAAAGGCTTCCCT
TGGCTCCCAAGGAGGTGTAGCAGGTGTGAGCAATATTAGTGCCATGTGCCTTTCACACAG
GGTTTGCATTTATCAGTCTGTTTTCCGATGATGTGTACATGAAAGAGTACACCATGTGAA
GAGAAGAGAGAATGATTGAAAATGTTTTAGTATAGAACTCTTCTTGCAGTGGGTTGCTAT
TTTCTAGATTTTACTTTTTAGGGAACAAAATAAAATCCTTTGTTAAAACTGGG
tcagagaattctgttgtcatattttgaagtatcagatttatgtcctaaagggcagaggct
tccttcttcctaggattggcatgagtaatttcttccaaagacagatacataagattttat
ataatgaaaatggaggaacagctgaagaacgtgtgatgtcaccacatatcttggtccact