Gene PRDM2 Variant 1
DNA : 120.22 KbNT_004873
mRNA : 7958 bp NM_012231
CDS : 5157 bp NP_036363
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  791 bp
atatgtagttctattaagacctatgttaaactctggtgggataattccgtggcactttca
cataatttaaattatgccatgtaagagtcactaaacccttatatacttcagtatgaatcc
tgtacattgcccaagaccttgttaagagaatgtaaattaaatataaattggagtatcagt
GTAAAAGTGACATTCTAAATGTTCCTCACTCTGCGAGGCTTATTTTTTAGGGACTTTGCT
ATAATTCTGAAAGACTTAGTTTTACAGTACATCTGAAAGTAGGAGTTTTCAGAAGTATGG
CTCTTGGGATAAATTTAGATTCTTAATTGTGAAGCTCTGTTACCACTTGTTAGAAGGCAG
GTCAGCTCACCTGCTTGGGGAGGTAAATATATGAATGCACTCTCGAGTAATTTAATGGAG
CCCTACCTCAATGTACAGAATGACAGTATCACAGATCAAGAATGGAGTACGAGTGATTTT
CGGCTATGGTGGGGGTAGGTAGGTCACTTGTCCCCTGTTGTCTCTTACTATTTGTAAAGT
GAAGACTATGATTAGTCTTTTTGATCGGGATGGTTTGAGATGAATAAAGAATAGGCAGGC
AATTTGGATACTTTAGGCTTTTCAAGAACATTAGTAACATTTTTTCTTAGATATTTCTCC
TAATACAATGAGTGTTGTGAAATAACATGGCAGTTATTGTTGAGAGAAAAGCCTTCCCAG
TTATGTATTGAGTCCTTAGGCGTTTTGACCTTCCCTCCACTCTTACAGAACTTGGTGGAA
GGGGCCACTATGTTTTCTACCTCCTTCCGTGCCTTTCACAAAGCCACATCCTGCACCGTC
TACCCTTCTCTGTGGATATTTTTCCGCTTGGCAATTTCCTTTCCTGAGGCACCCACTTGG
GACATCTGAATCTCCATCTCCATGTTGATGGCCCGTTTGTGCTTGGACGTGTTCTTCCAC
TTGAGACTGAG
gtacttttcccgggaaggtcgggcatctccttagagtcagtaaaatggagctcactggcc
aggcgtggtggctcatgcctgtaatcccagcactttgggaggccgaggctggtggatcac
gaggtcaggagttcgagaccagcctggccaacatggtgaaaccccatctctactaaaaac
EXON 2  74 bp
tctattttactggagataataaatctgacaaggaagctctcagcatagattgaagttgat
ttggcatagagttgctttataaatagccctttcagcaaactctacagttctgtatgtggt
tttaaatccctgtaaatttgtaggcaggtacatattacaattgtctgtttttctttttag
GGTTCATGTAATCAAAGAAGTTTCTTTGTTGTGTGTATCTTTACAGAACACAACAGGAAT
TGAAAATGAATCAG
gtgagtttaaaaatcagaatttatacaaatacatgacctagatgttagaccagctcttga
tttttacaagatagtagcacacacattcatttctcctggattctcatttttgtttcttaa
taccattaattagttcattgtgttcataccgtgcatttgttcgtgcagtggaatgtgcat
EXON 3  118 bp
gttacaaacaagcatcaaagcagctcctcaaatgcttgacatcatcgttttggtctgtct
tgccagcttcaggtttcggttacatttttgcatacttgcttattgaaccagaaaaaaaaa
aaaacccatgatttgagttttctttcttttgctgtgatccttccatttcttgacttgcag
AACACTACTGAGCCTGTGGCGGCCACCGAGACCCTGGCTGAGGTACCCGAACATGTGCTG
CGAGGACTTCCGGAGGAAGTGAGGCTTTTCCCTTCTGCTGTTGACAAGACCCGGATTG
gtgagtgctcctcctgtcacggagcaagtcaggcagtaaagagcaggtggcagtgaggct
tcctgcaggggcatgtcaggtagggagcgcaccataaaagcagcaatttacccttgactt
agaagattatatggtgttgatgcattttctagtcaagaatccaggttggacatgggttgt
EXON 4  104 bp
aaaaataaaaatccccattgaggacttgacttaatttaacttgatctcaggctattttaa
cattagcttgatttaggcagtctagccttttaactgttttgtgaaacttaagcgatttta
atggtttcaatctttaaaataaccatgatacattataaaaatactgattttattttctag
GTGTCTGGGCCACTAAACCAATTTTAAAAGGCAAAAAATTTGGGCCATTTGTTGGTGATA
AGAAAAAAAGATCTCAGGTTAAGAATAATGTATACATGTGGGAG
gtaagaagtaattctgattctttgtttttcagagttttatgaaataattattctgttctc
tcagaatttgacattttgaatttaaaacaatcattttaatgtgttctttaaagtcaagaa
tatttttattaaagagaaaatgtgtttccctggatacagactgctatttatatatgcttt
EXON 5  153 bp
cgaatttcagttttcaccttgtatttttcttttctctgtcgcttgttttgtttttatgaa
atgctttatatagagtacttgcatataatgaaaaagaattatccttaaaagttaaaaatg
gaggcattttaaagatactcctattttaacaaaagttttttacttttctccattttcaag
GTGTATTACCCAAATTTGGGATGGATGTGCATTGATGCCACTGATCCAGAGAAGGGAAAC
TGGCTGCGATATGTGAATTGGGCTTGCTCAGGAGAAGAGCAAAATTTATTCCCACTGGAA
ATCAACAGAGCCATTTACTATAAAACTTTAAAG
gtaacagcattagaattaatttactgttagttacgctgcttgtgttttcctttttctttt
tttgagacggtctcattctgtctctcaggctggagtgcaggggctccatcacggctcact
gcagcctaagcctccccagccttgggcgatcctcggacctcaacctcccgagtagccagg
EXON 6  127 bp
tccgggcgccggcgcggcccgcacggggccgggagcccttcctgccggccgggtgcgcgc
ggcgccgccgacagctgtttgccatcggcgccgctcccgcccgcgtcccggtgcgcgccc
cgcccccgccaacaaccgccgctctgattggcccggcgcttgtctcttctctccccgcag
CCAATCGCGCCGGGCGAGGAGCTCCTGGTCTGGTACAATGGGGAAGACAACCCTGAGATA
GCAGCTGCGATTGAGGAAGAGCGAGCCAGCGCCCGGAGCAAGCGGAGCTCCCCCAAGAGC
CGGAAAG
gtaggagccccccggcccgcccgcccggccccggcgccacgcccgcccaggacgccgccc
tgccgccctcgctgctgctggcccgaccgcgaggcgggtcgcgggctcgggcggcggcgc
ccgcggcatctcggtgaccttttccggactcggccctgccccggccccgctcccgccctg
EXON 7  111 bp
tttacagtcatcattcattcctttctttaggaatccaaagtggtaattgcccaggaatat
acagtgttcttgattggattaataattatcttcagtaattcagaataacacatgagggaa
tgaatgaatgaataaataaaaaaaaaatgaatgaataaattaaaaaaaattgtgtttcag
GGAAGAAAAAATCCCAGGAAAATAAAAACAAAGGAAACAAAATCCAAGACATACAACTGA
AGACAAGTGAGCCAGATTTCACCTCTGCAAATATGAGAGATTCTGCAGAAG
gtaagcttgtgatattggcttggtctgaattgggtgtgtatgtacccagtgaatttaact
ttgtatctctttatattgtccttctgagaatcatttaggatctttacgaggttaaacagc
aaaaaagctgcctaaatttaatgtggtaagctgagccttctatatgctaccttcccttca
EXON 8  4414 bp
gattcatatccaatacaactttgtcaattaagtatataaagtagaagtaatttattgttc
atcatcatctcccttatgttttaggtggtaagagaaataacttgaatcattcagattgtt
caccaagtagctggtttcccatgcttcacttccatgcttctgcttccatgtgctttctag
GTCCTAAAGAAGACGAAGAGAAGCCTTCAGCCTCAGCACTTGAGCAGCCGGCCACCCTCC
AGGAGGTGGCCAGTCAGGAGGTGCCTCCAGAACTAGCAACCCCTGCCCCTGCCTGGGAGC
CACAGCCAGAACCAGACGAGCGATTAGAAGCGGCAGCTTGTGAGGTGAATGATTTGGGGG
AAGAGGAGGAGGAGGAAGAGGAGGAGGATGAAGAAGAAGAAGAAGATGATGATGATGATG
AGTTGGAAGACGAGGGGGAAGAAGAAGCCAGCATGCCAAATGAAAATTCTGTGAAAGAGC
CAGAAATACGGTGTGATGAGAAGCCAGAAGATTTATTAGAGGAACCAAAAACAACTTCAG
AAGAAACTCTTGAAGACTGCTCAGAGGTAACACCTGCCATGCAAATCCCCAGAACTAAAG
AAGAGGCCAATGGTGATGTATTTGAAACGTTTATGTTTCCGTGTCAACATTGTGAAAGGA
AGTTTACAACCAAACAGGGGCTTGAGCGTCACATGCATATCCATATATCCACCGTCAATC
ATGCTTTCAAATGCAAGTACTGTGGGAAAGCCTTTGGCACACAGATTAACCGGCGGCGAC
ATGAGCGGCGCCATGAAGCAGGGTTAAAGCGGAAACCCAGCCAAACACTACAGCCGTCAG
AGGATCTGGCTGATGGCAAAGCATCTGGAGAAAACGTTGCTTCAAAAGATGATTCGAGTC
CTCCCAGTCTTGGGCCAGACTGTCTGATCATGAATTCAGAGAAGGCTTCCCAAGACACAA
TAAATTCTTCTGTCGTAGAAGAGAATGGGGAAGTTAAAGAACTTCATCCGTGCAAATATT
GTAAAAAGGTTTTTGGAACTCATACTAATATGAGACGGCATCAGCGTAGAGTTCACGAAC
GTCATCTGATTCCCAAAGGTGTACGGCGAAAAGGAGGCCTTGAAGAGCCCCAGCCTCCAG
CAGAACAGGCCCAGGCCACCCAGAACGTGTATGTACCAAGCACAGAGCCGGAGGAGGAAG
GGGAAGCAGATGATGTGTACATCATGGACATTTCTAGCAATATCTCTGAAAACTTAAATT
ACTATATTGATGGTAAAATTCAAACTAATAACAACACTAGTAACTGTGATGTGATTGAGA
TGGAGTCTGCTTCGGCAGATTTGTATGGTATAAATTGTCTGCTCACTCCAGTTACAGTGG
AAATTACTCAAAATATAAAGACCACACAGGTCCCTGTAACAGAAGATCTTCCTAAAGAGC
CTTTGGGCAGCACAAATAGTGAGGCCAAGAAGCGGAGAACTGCGAGCCCACCTGCACTGC
CCAAAATTAAGGCCGAAACAGACTCTGACCCCATGGTCCCCTCTTGCTCTTTAAGTCTTC
CTCTTAGCATATCAACAACAGAGGCAGTGTCTTTCCACAAAGAGAAAAGTGTTTATTTGT
CATCAAAGCTCAAACAACTTCTTCAAACCCAAGATAAACTAACTCCTGCAGGGATTTCAG
CAACTGAAATAGCTAAATTAGGTCCTGTTTGTGTGTCTGCTCCTGCATCAATGTTGCCTG
TGACCTCAAGTAGGTTTAAGAGGCGGACCAGCTCTCCTCCCAGTTCTCCACAGCACAGTC
CTGCCCTTCGAGACTTTGGAAAGCCAAGTGATGGGAAAGCAGCATGGACCGATGCCGGGC
TGACTTCCAAAAAATCCAAATTAGAAAGTCACAGCGACTCACCAGCATGGAGTTTGTCTG
GGAGAGATGAGAGAGAAACTGTGAGCCCTCCATGCTTTGATGAATATAAAATGTCTAAAG
AGTGGACAGCTAGTTCTGCTTTTAGCAGTGTGTGCAACCAGCAGCCACTGGATTTATCCA
GCGGTGTCAAACAGAAGGCTGAGGGTACAGGCAAGACTCCAGTCCAGTGGGAATCTGTCT
TAGATCTCAGTGTGCATAAAAAGCATTGTAGTGACTCTGAAGGCAAGGAATTCAAAGAAA
GTCATTCAGTGCAGCCTACGTGTAGTGCTGTAAAGAAAAGGAAACCAACCACCTGCATGC
TGCAGAAGGTTCTTCTCAATGAATATAATGGCATCGATTTACCTGTAGAAAACCCTGCAG
ATGGGACCAGGAGCCCAAGTCCTTGTAAATCCCTAGAAGCTCAGCCAGATCCTGACCTCG
GTCCGGGCTCTGGTTTCCCTGCCCCTACTGTTGAGTCCACACCTGATGTTTGTCCTTCAT
CACCTGCCCTGCAGACACCCTCCCTTTCATCCGGTCAGCTGCCTCCTCTCTTGATCCCCA
CAGATCCCTCTTCCCCTCCACCCTGTCCCCCGGTATTAACTGTTGCCACTCCGCCCCCTC
CCCTCCTTCCTACCGTACCTCTTCCAGCCCCCTCTTCCAGTGCATCTCCACACCCATGCC
CCTCTCCACTCTCAAATGCCACCGCACAGTCCCCACTTCCAATTCTGTCCCCAACAGTGT
CCCCCTCTCCCTCTCCCATTCCTCCCGTGGAGCCCCTGATGTCTGCCGCCTCACCCGGGC
CTCCAACACTTTCTTCTTCCTCCTCTTCATCTTCCTCCTCCTCTTCGTTTTCTTCTTCAT
CTTCCTCCTCTTCTCCTTCTCCACCTCCTCTCTCCGCAATATCATCTGTTGTTTCCTCTG
GTGATAATCTGGAGGCTTCTCTCCCCATGATATCTTTCAAACAGGAGGAATTAGAGAATG
AAGGTCTGAAACCCAGGGAAGAGCCCCAGTCTGCTGCTGAACAGGATGTTGTTGTTCAGG
AAACATTCAACAAAAACTTTGTTTGCAACGTCTGTGAATCACCTTTTCTTTCCATTAAAG
ATCTAACCAAACATTTATCTATTCATGCTGAAGAATGGCCCTTCAAATGTGAATTTTGTG
TGCAGCTTTTTAAGGATAAAACGGACTTGTCAGAACATCGCTTTTTGCTTCATGGAGTTG
GGAATATCTTTGTGTGTTCTGTTTGTAAAAAAGAATTTGCTTTTTTGTGCAATTTGCAGC
AGCACCAGCGAGATCTCCACCCAGATAAGGTGTGCACACATCACGAGTTTGAAAGCGGGA
CTCTGAGGCCCCAGAACTTTACAGATCCCAGCAAGGCCCATGTAGAGCATATGCAGAGCT
TGCCAGAAGATCCTTTAGAAACTTCTAAAGAAGAAGAGGAGTTAAATGATTCCTCTGAAG
AGCTTTACACGACTATAAAAATAATGGCTTCTGGAATAAAGACAAAAGATCCAGATGTTC
GATTGGGCCTCAATCAGCATTACCCAAGCTTTAAACCACCTCCATTTCAGTACCATCACC
GTAACCCCATGGGGATTGGTGTGACAGCCACAAATTTCACTACACACAATATTCCACAGA
CTTTCACTACCGCCATTCGCTGCACAAAGTGTGGAAAAGGTGTCGACAATATGCCGGAGT
TGCACAAACATATCCTGGCTTGTGCTTCTGCAAGTGACAAGAAGAGGTACACGCCTAAGA
AAAACCCAGTACCATTAAAACAAACTGTGCAACCCAAAAATGGCGTGGTGGTTTTAGATA
ACTCTGGGAAAAATGCCTTCCGACGAATGGGACAGCCCAAAAGGCTTAACTTTAGTGTTG
AGCTCAGCAAAATGTCGTCGAATAAGCTCAAATTAAATGCATTGAAGAAAAAAAATCAGC
TAGTACAGAAAGCAATTCTTCAGAAAAACAAATCTGCAAAGCAGAAGGCCGACTTGAAAA
ATGCTTGTGAGTCATCCTCTCACATCTGCCCTTACTGTAATCGAGAGTTCACTTACATTG
GAAGCCTGAATAAACACGCCGCCTTCAGCTGTCCCAAAAAACCCCTTTCTCCTCCCAAAA
AAAAAGTTTCTCATTCATCTAAGAAAGGTGGACACTCATCACCTGCAAGTAGTGACAAAA
ACAGTAACAGCAACCACCGCAGACGGACAGCGGATGCGGAGATTAAAATGCAAAGCATGC
AGACTCCGTTGGGCAAGACCAGAGCCCGCAGCTCAGGCCCCACCCAAGTCCCACTTCCCT
CCTCATCCTTCAGGTCCAAGCAGAACGTCAAGTTTGCAGCTTCGGTGAAATCCAAAAAAC
CAAGCTCCTCCTCTTTAAGGAACTCCAGCCCGATAAGAATGGCCAAAATAACTCATGTTG
AGGGGAAAAAACCTAAAGCTGTGGCCAAGAATCATTCTGCTCAGCTTTCCAGCAAAACAT
CACGGAGCCTGCACGTGAGGGTACAGAAAAGCAAAGCTGTTTTACAAAGCAAATCCACCT
TGGCGAGTAAGAAAAGAACAGACCGGTTCAATATAAAATCTAGAGAGCGGAGTGGGGGGC
CAGTCACCCGGAGCCTTCAGCTGGCAGCTGCTGCTGACTTGAGTGAGAACAAGAGAGAGG
ACGGCAGCGCCAAGCAGGAGCTGAAGGACTTCAG
gtaagctcaggagctggtgggagggaaagaccgggaaggcgacagtatccttgcctacgg
gtgttttttggtttcttgttgcttttttttttttttttccccacttaaaggaaatagctg
ttgtataagttaaaggcatgaagggtcattgctttggctgcttttagagatgaataaata
EXON 9  144 bp
ggtggttaaagctcatgtcctattagctgatgccaggcacctggcctcaaggtgtccagg
aagtgcaatcctatcctggcctgggaagtggtgaccagcactaaggaagcccccccagca
atgtctagggcaccgggctgggctcctgtgacaatgtgtgttgttcctcttcctgcacag
CTACAGCCTCCGCTTGGCGTCCCGATGCTCTCCACCAGCGGCCCCGTACATCACCAGGCA
GTATAGGAAGGTCAAAGCTCCAGCTGCAGCCCAGTTCCAGGGACCATTCTTCAAAGAGTA
GACACTCTGGCTGCTCCCTGACAG
gtacgaggcaggatggaacagcttctggcactgtttgggtgggtcaagggggtgtgggct
tgggtcttgggtggggagggaaggagagaaagcagtgggtgtgattgcttgtgtgtacca
ggcacggtgcagggcctccctccaggagggcacttagctgagtgcagactccggaccact
EXON 10  1922 bp
gtgccagctctgcaggtgtattcactgtgaacattcatcaagctgtgctttttgctctat
gtatggtatgtttcaataaacagtttagttacaaaattaagtgcaataacgcatggacca
ccatggtcggcactgaatgtgtgcttactgttattatttttattttctttttctcctcag
CACCTGAAGTGACCTGGAATCAGTGAAGCCAAAGGGACTGGCAGTCTGCCCTGCAGGGAG
TACCGACCTATCCCAGTTGTGTGAGGCTGCGAGAGAAAGGGAGTGCATGTGCGCGCGTGC
ATGTGTGCGTGCGTGTGTGTTCACGTGTTCTCGTGCGGGCGCGTGAGTGGTCTTCAAACG
AGGGTCCCGATCCCCGGGGCGGCAGGAAGGGGGCCGACTCCACGCTGTCCTTTGGGATGA
TACTTGGATGCAGCTCTTGGGACCGTGTTCTGCAGCCCAGCCTTCCTGTTGGGGTGGGGC
CTCTCCTACTATGCAATTTTTCAAGAGCTCCTTGACCCTGCTTTTTGCTTCTTGAGTTGT
CTTTTGCCATTATGGGGACTTTGGTTTGACCCAGGGGTCAGCCTTAGGAAGGCCTTCAGG
AGGAGGCCGAGTTCCCCTTCAGTACCACCCCTCTCTCCCCACCTTCCCTCTCCCGGCAAC
ATCTCTGGGAATCAACAGCATATTGACACGTTGGAGCCGAGCCTGAACATGCCCCTCGGC
CCCAGCACATGGAAAACCCCCTTCCTTGCCTAAGGTGTCTGAGTTTCTGGCTCTTGAGGC
ATTTCCAGACTTGAAATTCTCATCAGTCCATTGCTCTTGAGTCTTTGCAGAGAACCTCAG
ATCAGGTGCACCTGGGAGAAAGACTTTGTCCCCACTTACAGATCTATCTCCTCCCTTGGG
AAGGGCAGGGAATGGGGACGGTGTATGGAGGGGAGGGATCTCCTGCGCCCTTCATTGCCA
CACTTGGTGGGACCATGAACATCTTTAGTGTCTGAGCTTCTCAAATTAGCTGCAATAGGA
AAAAAACAAATTGGGAAATGAAAAAAAAATGGGAAGATTAAAAAGCACAGGGGGAAGAAG
AAGAGATTTCGGAGGCCATCCTGCCAGGGGCGGACGGGGCTGACTCCTGCTCTCTGGAGG
ACGGTCAGTCCATGTCTCGGAGAAACGGGTGAGCTGAGCTTGGCGTTTGGACCCAGTTCA
GTGAGGTTCTTGGGTTTTGTGCCTTTGGGGCAGACCCCAGGCAAGGATGTCTGAGACCAC
TTGGGCGCTGTTTTCTCAGCTCCAATTTCAAGAGTGAGCTATCAAACCCAGAGCGGAAGG
AGGGAGCTCTGATGAGCACGGTTTGTCACACGATAAAGGGATTTTTTTTTTCAGGGCTAC
TACGGTTGATCTTGCAACTCTGTAAATATGTATGTAGACACTTTTAAAAGCACGTATTTA
TGTCCCTGACTGTAAATGCTCCATTTTTAAAGTTTTATAACTTGTGTTATTTAATGAGTC
AGTCAATCGGCTGCAGTATGGGATCTGATAAGGATCTAGGAGAAGGGTCTCATGCGGACC
CTCACATGGGCAGAAAAATGGTGGTCATTGGCCGACATCACAGTTTTCCTGTTTCCCACC
CAGCTAAAAACCGTTGTTTGCTTTAAATTTTCATAAACTGGAATCCTTTCACCCGCTCCT
ACAGCTAACCCTCACAAGCATGAAGTGCTGTGGCTGTTCCTTATCCTAATGATGCGCTTT
TGTCCCGTAAATGTTAACACTCATGAAGCATACCCCGGCCTCTCAGTTCTTGAGGGCCTC
CCCACCGCAGCAGCAAGGAAAGCTCACGAACCCCAAACCTGGCAAGTCACCTGCAGCCCA
TGGTGAGCTCTGGGAAGTGTGGTTGAGGCCTTGGGGTCACTCCTTTTTTGCATGTGCAAA
TGTGCTGGTCACCCTTCAACGCTCCCAGACGGTCAGGAAAACTGTTCCAATCATGAAAAG
GGGGGATGATTTTGTAAAAGTGGCATTTCCTGGTCAGTGGTGGTCTTCAAGACGACAGCT
CTGTATCTGCCATGTGAAGAGAATTAACAATAAAAGTGTGAAGAGCGATTGTGAGGAACA
AG
cctgggagtgatcattctggtttctgtgctctgtcttctgtgttggtggttttggtggga
gggcggtgggggtccctgaatgctccctcccagcaacgggaggaaccaagggctcaagga
agctcactctggaaacgtcccatctggtaagtaaggctactctgccacctgccagccagt