Gene PIP5K1A Variant 1
DNA : 50.93 KbNT_032962
mRNA : 3715 bp NM_003557
CDS : 1650 bp NP_003548
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  486 bp
tccacccgtggactcgtcagggcgtgaggacccacctcacgtgaccattagcagcctccc
gattggttttgctccttttttctccccaatgagtgggctgatgccccgagaaggtcgggc
gcatgcgcagtgctcggattttttgcttggctacccggagtgaagcggccgggttgggcg
ATTAACAGGCCGTGGTTAGGAAGGACGGAGAAGGGGCGTTCGCTCCTTTGGGACTTTTCA
TGCCTCGTTTTTTTTTCAGATGTGGCTTGGTCTGGGCGCAAGGTCCCAGCAGCCAGCTTA
AGCTTACTCTTCTGTGAAAGGGGAAAGTATCCCCTGTGGAAAGCGGTTAAACTTGTGGAG
GGGGTGCGGGACGTGAGTTCTTCCCCATGCCAGGCGAATGGTGTGGCCTTGAGCTGGTCC
AGGAGCCGGCTCGACGTGTCTGAGGGAGGCCCCGGAGGGGGCGGGGAGGTGGCCCACAGA
ACGCGGGTTCTGTAAAGAGACGTTGGGAAGATTCGATTCCGAGAAGAGGAAGAACCGGAT
TGAAAGAGAGCCAGGCCGCTGAGGGGGAGGGGGCTGCTAAGATGGCGTCGGCCTCCTCCG
GGCCGTCGTCTTCGGTCGGTTTTTCATCCTTTGATCCCGCGGTCCCTTCCTGTACCTTGT
CCTCAG
gtaagcccggcagggcgtgggtagggagctggtgaggaatatgcgatgggaggaagagcg
agacctaagagggtacctgtagctgggaatgtcctacgtgttaccggtaagtgggcgcga
gctgggctttcaaatagggatttatgagcgggcaggagtttgaggaaaggataagtttga
EXON 2  32 bp
atggagaaggagagagggacatacacagttgctatccaaaaggatctggtattactgagc
aagaggcaggagtttatacttatgtttagtttgactcaaactctgatggtttcagtatgc
ttgacagagatgtgagtgtgtgatacactcttatgattgtttttttttcccccctagcag
CATCTGGAATCAAGAGACCCATGGCATCTGAG
gtgagtttcatactgatacaatggttactaaaaccttaattctgggatagaaggaacctg
tttatgacatttttattttttctctacttaggtcttggaagctagacaggattcttacat
ctcattggtaggctagaaattatgcaactcatcttttattgtagtttattttaaatatta
EXON 3  81 bp
attcattgggaaccaacattatagctgtatatttgcatgggatagatctgaagattttgt
aaaatgtttttaatctagaaagaatatgttgtttcagtttattttgttttgatgtaccat
tgtggtagctatttggtgtcttacatgggaattgtattataatcttgactcttcttctag
GTGCCTTATGCCTCTGGCATGCCCATCAAGAAAATAGGCCATAGAAGTGTTGATTCCTCA
GGAGAGACAACATATAAAAAG
gtgtgtctggatgaaaccgtctcatcttactccaggagctcagcagcttactctgggaac
tcagtctccttgaaattactctccatgtactgtcctgtttcttgatctcctaagcttttg
cacataatacagcttagactttagatttatttctcaaagggtaaattgtctcctttttgt
EXON 4  131 bp
ttaattgcagagtacagcatagggatggggaaactggattgtcccagttttatctgaact
attgctcagactaaaggatgtttgttttaaagtgttccttctagcttcccctttctgaat
ttttattgttatgatcctacttatactaggaattttcttctcatttctcttgtttctcag
ACAACCTCATCAGCCTTGAAAGGTGCCATCCAGTTAGGCATTACCCACACTGTGGGGAGC
CTGAGTACCAAACCAGAGCGTGATGTCCTCATGCAAGATTTCTACGTGGTTGAGAGTATC
TTCTTTCCCAG
gtacagagtttaatgttcaggagcatgtcctggaaatgtggccttttcaaatcagcccag
ggcagttttaggggttcaggtcggacaatttagacatgtgtccatttcttaacctggtta
caatcagggcgatgtgggactagagagttcggagagcagatactgtcctctagatgcttc
EXON 5  118 bp
tcttgctgtccatgctgtgccattgtctcactaactcatctaagaagggctgtgattatc
ttaggaggaatgtattcccccactccccccaccatgaggtgactctgagtgtcttcgcaa
ggtagattctctggatgatagggactggcaagttatggctacctctgtttaaccccacag
TGAAGGGAGCAACCTGACCCCTGCTCATCACTACAATGACTTTCGTTTCAAGACCTATGC
ACCTGTTGCCTTCCGCTACTTCCGGGAGCTATTTGGTATCCGGCCCGATGATTACTTG
gtaagcatctggatatcaggacactgtgactccagtatcagagggatattcccaaaggaa
ggccccttttctccacagtctcgctctggtttttatttagaaaagaattgcatctgtagt
tgatttttgtgttgggcaaggccctgatgtgtctaaatctcttagttcttctctgtttgc
EXON 6  153 bp
catctggatatcaggacactgtgactccagtatcagagggatattcccaaaggaaggccc
cttttctccacagtctcgctctggtttttatttagaaaagaattgcatctgtagttgatt
tttgtgttgggcaaggccctgatgtgtctaaatctcttagttcttctctgtttgccccag
TATTCCCTCTGCAGTGAGCCGCTGATTGAACTCTGTAGCTCTGGAGCTAGTGGTTCCCTA
TTCTATGTGTCCAGCGACGATGAGTTCATTATTAAGACAGTCCAACATAAAGAGGCGGAA
TTTCTGCAGAAGCTGCTTCCAGGATACTACATG
gtaagggagagagaagcactgtccacctgtgctgctcacttctgggcaaggctggggagg
ctgtcttcagcagggtaaaacagtgtcagcacttctatcttaagagtgtagttcaggcca
ggcacggtggctcatgcctgtaatcccaggactttgggaggccgaggcaagaggatcaca
EXON 7  300 bp
cttaccattgaaatagatgcatagggaaatgtaaagcatatatgatgtaggtttatggac
acattgtgtctaaatctcatataggagataaagggaggatgggtggtaacttttactggt
gagtttcactgaaaatcagctaagttgttctcctacttctgtttccttttgtgttctcag
AACCTCAACCAGAACCCTCGGACTTTGCTGCCTAAATTCTATGGACTGTACTGTGTGCAG
GCAGGTGGCAAGAACATTCGGATTGTGGTGATGAACAATCTTTTACCAAGATCGGTAAAA
ATGCATATCAAATATGACCTCAAAGGCTCAACCTACAAACGGCGGGCTTCCCAGAAAGAG
CGAGAGAAGCCTCTTCCCACATTTAAAGACCTAGACTTCTTACAAGACATCCCTGATGGT
CTTTTTTTGGATGCTGACATGTACAACGCTCTCTGTAAGACCCTGCAGCGTGACTGTTTG

gtgagtttgttacttagacatcaaaaatctcagttactaaaacagcttgattgttcttag
gcattaagtttgtgggagatggaactctgttccttagcactgtatgtcctgggctgtatt
taaaataagtcttaattagttcattgccattcctttacatttttactttctccccgttta
EXON 8  206 bp
aagtaggtggatattttgagcctgggaggttgcagctacagtgagccgagatcacaccac
tgcactctagcctgggttacagattgataccctttctcaaaaaaacaaaaaaattgtgag
atcctgaaaaatatttttatttcttccaaggctcagatcatgtttttttccttccattag
GTGCTGCAGAGCTTCAAGATAATGGATTACAGCCTCTTGATGTCAATCCATAATATAGAT
CATGCACAACGAGAGCCCTTAAGCAGTGAAACACAGTACTCAGTTGATACTCGAAGACCG
GCCCCCCAAAAGGCTCTGTATTCCACAGCCATGGAATCCATCCAGGGAGAGGCTCGACGG
GGTGGTACCATGGAGACTGATGACCA
gtaagtgggctcagggccactaggggggagaacataggcccacagcacttttcttttctt
ttttttttttttttttttttagtttcactcttgttgcccaggctgatgtgctgatgtgca
atggcacgatctcagcctactactacctccacctcctgggttcaagcgattctcctgctt
EXON 9  84 bp
atctcattttctcctgtttttttaatgtatttttttctctttttgttttcttgatcactt
attatctgaccttctggtttatggaggatgaggcagttatgtgtaggtttcacttcccca
tcctgatctgactaaactagccaacagattttctcaccctttcctttttgccttttccag
TATGGGTGGCATCCCTGCCCGGAATAGTAAAGGGGAAAGGCTTCTGCTTTATATTGGCAT
CATTGACATTCTACAGTCTTACAG
gtgaggagcatatggatcccaaattaagagagggtggatacagataaccagtcacgtttc
tcttttagataggtttgttaccaagttcttccggaagcaagaacagtgagttgcagtctg
gctacttacttcattagttttcagatggtttatttccttgattttgcctctttccccggc
EXON 10  49 bp
ctgtgatgaaccagcactgccatgcctgttcttgggaaaaccagtgtaccagtagatgtg
ctttctcagcttctgtcttttcaagattttctattacccctttaaccccctaaaatataa
agttattaaggtcatttatttaaaaatgacgtgagtaggtgatgtacatttttcttgcag
GTTTGTTAAGAAGTTGGAGCACTCTTGGAAAGCCCTGGTACATGACGGA
gtaagtagtaatactagaggctctcttaccgtacacttctgcctccatcacttctgattg
gcctcagtttcttgcaattttttcttttttcttttttcttttttttttttttgagacagg
gtctcactctgtcacccaggctggagtgcagtggcgtgatctcggctcgctgcaacctcc
EXON 11  85 bp
acctcagcttcccaaaatgctaggattacaggtgtgagccactacgtctggccccttccg
tttatttcatctgtaggttttacccttctgctaggggctcagtctgggggaagatggccc
ttggactagagttcctcttgccgggcctcctaactctatagcatttcttctgctctgcag
GACACTGTCTCAGTGCATCGCCCAGGCTTCTACGCTGAACGGTTCCAGCGCTTCATGTGC
AACACAGTATTTAAGAAGATTCCCT
gtaagtggtttctaccaattgactgcctactcctgcccagtggctcccttaccccaagag
aacagagggcaggacacctctggtagggagctgccaatgccagaggcctctccttccacc
tacatcccatgagagccatttcttgtcctttgtgttagtctgtcatagtcatttccaagt
EXON 12  147 bp
tgagctaacaccttgttctctgaatagtaattcataggcctgtctttgttgacattagcc
ttttcacttttcagaccaactttgggtgtgtgttggggatactagcaattatttgtatct
atgtcttggtaatagttgctaaggtagttgctaagtaggctctctctttcccttttgaag
TGAAGCCTTCTCCTTCCAAAAAGTTTCGGTCTGGCTCATCTTTCTCTCGGCGAGCAGGCT
CCAGTGGCAACTCCTGCATTACTTACCAGCCATCGGTCTCTGGGGAACACAAGGCACAAG
TGACAACAAAGGCAGAAGTGGAGCCAG
gtcagcgctagggctggggtccccatgtgattgggtactccctcccttccttctgagcct
ttatcttgtctggccaggacctctgctcccatttctatccaggaagcctagctgctacat
atttttccttgtatttactgtaccccatcttctctatcttttttccaggcgttcaccttg
EXON 13  130 bp
aagtggagccaggtcagcgctagggctggggtccccatgtgattgggtactccctccctt
ccttctgagcctttatcttgtctggccaggacctctgctcccatttctatccaggaagcc
tagctgctacatatttttccttgtatttactgtaccccatcttctctatcttttttccag
GCGTTCACCTTGGTCGTCCTGATGTTTTACCTCAGACTCCACCTTTGGAGGAAATCAGTG
AGGGCTCGCCTATTCCTGACCCCAGTTTCTCACCTCTAGTTGGAGAGACTTTGCAAATGC
TAACTACAAG
gttggtttattggcccctttctccatataatcttatctctcttttcaagtccttggaaac
ctctataatttgattgcatcataataaattaccccaaagattagtggcttaaaataacaa
acatatatcatactttctgtgggtcaggaatccaggcccagcttagctgggtcctctggc
EXON 14  46 bp
aatatggttaattaaaacagtgtgcttctaaatctagtagcttctcagcctcttctttcc
aaattctaaattgattccaaagtgaaaattagagaagcagtatgagatttaaaaggagag
tcctttgttgttgtcttctaattctttttctctctgcttccattttttttctcctgttag
TACAACCTTGGAAAAGCTTGAAGTTGCAGAGTCAGAGTTCACCCAT
gtgagtatctgggatgtgtgggaggtgaacgttttgcaaggtataaagaggatcactgat
ggcctggagcaggaagttaattgtcaagattagaggatctgggtacctcctaaatcttgt
tttttattttttattatttttttattttgtacttatttatttatttatttatttattttt
EXON 15  1667 bp
caaagtgctgggattacaggtgtgagccaccatgcgcggccgccatcttgttttttaaaa
aatatttttggtacctcatacttggaggctgaggctgaaatagaaatttcttaacgcttg
aattccatttctgcttaatctcatactccacatccttaactttacactctcccttttcag
TAAGCGCAAAGCCTCAGAAGACCTGGAACAAGATTCTGCCATCTCTGTGATCCCAAGATG
TCAGCCCTTGCCCCAGCAATGCTGAATTTTCTTCTACTTGGTCATCAAAAAAGGAGTGTA
ATAGAAGTGAGGGGAGCTGCTCCTCCATCTTCTTCCTGAAGAAGAACCTTCTCTCCTTCC
TCTTCCTCATGAATGGGCCTTAGTGCCTCAGAGAGTTGAGGACCGCAGCATCCCCTCCAC
TCCAGAGTTGGGTGGTATGGATTTTCAACTGGCCAACCCTTTGCCTCCACTATTGAATTT
TTTTCAGACCCCCATTCTTCATGCTGGAAATGGGATTGCTGGACTTGGCAGCTTTCTTTC
CCCTCGTCTTTGACTAGGAACCGGACTCTTAATTTCCTCAGGACAGACTAGCTGGCACAT
TATCCCTACCTTAGTTCTTTCTCTCTGACTCCTGGAAGAATACTCCTGTAATCTCTGTAA
AGGTTTTTGGGGGATAAGGGTGTTTAACCACCTCCCAGCTTTCTTCTTCTTTTTTTTTTT
CTGAAAAAAGGAAAAAGCACACAGCACACAATTTCAAGCCATTTTCAGATCAGAACTCCA
GAAGTGTTGACAAGATGCCTATTCGTAGAGTTCCCTCAGAAGAGCCATGGTGTTTATGAA
GAGAAGAGTAGTGATTGCTCTGCCAGAAGCAGCTCCTCTTTAAACTCCTCCTCTCTTGAT
GAATTTCTTAAGGCTGAAGGAATGAAGAGAGTGGGACATGGGGTAATCTTTATCCCTTTT
GTTAAAACAGGAGGCAGCCATGGGCTGGGAGATCATAGCCCTTCCTAGGCAGAATCCTGT
TCACTGCCAGGCTATAGTAATTATTACTATTTTGCAATTTGAAATATATTCTGGTTGTTT
TTCTAAATGTGAAGACTTACCAAATGAATTTTAGATCATTCTCCAGAGGAGATTTTTTTT
GCTCTTCTCATCTTTTCCAACAGTGTTCTCCTGTTTGTGGAGCTAAGGTAAAGAGGGGAC
ACTTCTGTCTGTTTAACAGACAGTCCATATCTGTGAGGCCAGCAAATATTTTCTTAAACT
CATGGGGAGACAGCAGATTCTTGCCTTGGTGAGGTCATTGCTGTGCCATATGTCCTACCC
CCCTGTCTTCATGCAGGGAAGTTGGAAATGGGGGCTACATATGCCCTCTCCTCCCCGTCT
ACAAGAGTTGTGGTTTTCCATCTGATCCTTCCACTCTTGTCAGGGGAAGAAGGGGGCCTG
GTATCTCAGGCAGATTGTTGAATTCCTGTTCTATCCCTTCTCTATCCCACCCTGCCTTGA
TAATATGTTAGCCCATACCCCAAATAACTGTCTATATTAGACACCCCCAGCCAGTTTCTG
GCTGCCTGTCTTTGCTGCCATGTTTTTTACAAGAAGGAAAGAATTCTTGCTATTTTTTTT
TCATAATTTACTATTTATGATGTATTTAAGTGTTTTATTAAGGACAGAGTTCTGTTAGGG
GTGGGAGGGAATATTTGAGGGAGGGCTGGGTCTTAGGGAAAGGAATGGGGAAGCAACATT
TTTATTAAGTGTTACTATTTGCCTCTACTTTGTATTGTTCAGAAATGGCAAATACAATAT
AAAAGTGATATATGGTTTTAATGTAATAAACTTTAATGAGTTATTTA
gacctcttattttttctgattctttttcatataccatctgctcaccctcctactccacca
cccaggctcagttttgttcatgttgccctaaacaaaggctgcatactttccagcttgcaa
cactccagcttcactcttaaggctttatgtccttatatcctcttcctcagcaaccccatt