Gene PGBD5 Variant 1
DNA : 55.97 KbNT_021973
mRNA : 3444 bp NM_024554
CDS : 1665 bp NP_078830
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  124 bp
agtgcttatcccaaatgtatgagccggatgctgcactgtgctttatgcacagtatttcat
tttattctcacaatgactctttgaggtggatactctaatctttgccattttacagatggg
gaaatgaaggctgtgtgggattatgtaccttgaccagggcacctgttcggtaggtcagat
ATGCCTGACTACAGAACTCGAGCTCTCTTCGTGCAAAGTACTCTCGGGGACTCTGCAGGA
CCTGAGCTGCAGTTGCTCAGCATAGTGCCCGGCCGGGATCTGCAGCCAAGCGATTCATTC
ACAG
gtacagctgtcttagtaaggcccttccagctctgggcaagagatcttttcatccatgtgt
tattggcatcttcatcatcatcatcacagcttctgcctttatgaaggatttatcacgtgt
tgatgtcagcatttcacctggatggccattgcttctttgtgcctatgacagtcactgctc
EXON 2  192 bp
gcacactcttcccggttgctttttggggaggggccacttggcctcagcaacacacatttc
taagaatttattttaggcatggaaaaaatcccaagtccatgtatatttcagtggtcagct
ttcagcttttatccatctccccaagccttctctctcctccaccttattcctcctccgcag
CCTCCTCCTCACCACCACCATCTGTGTGGTCAGAACTTGAGCACATCCGTGGAAAATCAG
AAGCAACCACAGAGCTAAAAAGACCCAGCCTTCCAGGGAGTATTCATTCCTGCCTATGTG
GGGTGTGGTGTGGCGTGGGGAAGAGAACCCCCAGCTCCTTGGTGTCCAGCTTGCAGGACC
TTGAGCTCCTTG
gtgtgccagcttgcgtgaccttgagcaagttctcttccccgagcctctgcattcacctgc
agagcgggagtctggtagccctgtgcttggctgttgcgagaatgaaattggacgcgagaa
tgctctttgtagtggttgatatgatgaagagcctccacggagtatgccggagtgtttttt
EXON 3  105 bp
gagatgaagaagctggcctgggggtcaggaggttcccccagaaggtgatgcttcatgaag
ctggagccccaggagggcttccttccaggaggatcaggccttgaggcgggaaagagcttg
ccacggtccaggtctgacacaggcttccccggcaagcctccacaactgtctgtcatccag
GCCAGAGGCAGCGACAGCTGTGGATGGAGTCGACGCCTCGGCCGCCCTATAATCCATTCC
TCGTGCCCTGCACACCCGTGGGGAAACTCAGTGCAGAGCATGGAG
gtgaaggagctggtagaggaagctaaatcccagccaggtctcacctgatttggggaacag
ccatcagatcctcccccaccctctcgtgcagcagagtgagcctgctgaagttgcaagagc
atggtcacgtggtgctcacagcccttcactggcttcccgcgcccttgggcaagtgtgagc
EXON 4  428 bp
ggagccggcactgtcaggtggttgcagcagcttctggaaggttggaggggaaggcggtag
cactggaggcagcgggggcactcggccagggacccagggattggaaatgcagccgttctc
gtgtcgagtcagggtgtggcggccgtcctaaggaacactccacctgtctttgggtttcag
GTCCCACCCGAAAGATGCCCCCCAGCGCCAGTGCCGTGGACTTCTTCCAGCTCTTTGTCC
CAGACAACGTCCTCAAGAACATGGTGGTGCAGACAAACATGTATGCCAAGAAGTTCCAGG
AGCGGTTTGGGAGCGACGGAGCCTGGGTGGAGGTGACGCTGACGGAGATGAAGGCGTTCC
TGGGCTACATGATCTCCACCAGCATCTCCCACTGCGAGTCCGTCCTCAGCATCTGGAGCG
GAGGCTTCTACAGCAACCGCAGCCTCGCCCTCGTCATGAGCCAGGCCCGCTTCGAGAAGA
TCCTCAAGTACTTCCACGTCGTGGCCTTCCGCTCCAGCCAGACCACGCACGGGCTCTACA
AGGTCCAGCCCTTCCTCGACTCCCTGCAGAACAGCTTCGACTCTGCCTTCAGGCCTTCCC
AAACCCAG
gtgaggcccacgcaggacgtaagagcttgtccaggtgtcctcgctctctcggcctagcct
tgtctgttggcagggctttggggtgtccttcctgccctgcctgccctctgagttcacttc
aaggtcacctctgctattcttccattccattaatccacataatccaaatgagatcggagg
EXON 5  135 bp
tagtatagataatgataccaccctcctatagataagaagggtcaggatcagagaggtaaa
gtaacttagttaaggtcacagagctgctcaaatgcagaggctgaatttgagctccaatct
gatgagccctcaagctcatgctgccttccgtgagagcctctgctttttccctcctggcag
GTGCTACATGAACCCCTGATCGATGAGGATCCTGTATTCATTGCCACGTGCACAGAGCGG
GAGCTGCGAAAGAGGAAAAAGCGGAAATTCAGCCTCTGGGTCAGACAATGTTCTTCCACT
GGCTTCATCATCCAG
gtgagccctgggctgagcccggggagggtcggtgaagagggtcggggaagaaaatccggg
cgacttgggctcatctgatacccaagaacttgttcacatacccttttcactgtgggtcca
agtccacccagatgctcctgcggaggccagggctgggctgctccctcctcaccgaggcag
EXON 6  181 bp
aggccacggggtgtgcttgggggtgacctagagtccctgtgagctgaaaagatgatgggg
gcttttccatgggctcccaactggatgactgagacccatgagatctgtgcttgctgaata
ctcgggctcccagcctgacactgctgtgagcacgctaacctctgtgtgtttctgttaaag
ATTTATGTCCACCTGAAGGAAGGTGGGGGCCCAGATGGCCTGGATGCGCTGAAGAATAAG
CCCCAGCTCCACAGCATGGTGGCCAGGAGCCTGTGCCGGAACGCGGCAGGCAAGAACTAC
ATCATTTTCACGGGGCCCAGCATCACCAGCCTGACGCTGTTTGAAGAGTTTGAGAAGCAA
G
gttagtcaagtggggagccagtgaggatacggcccagcctcccctgggaaagtggtggga
gaggtccaggtgggggtgcagatacgtggtggccaccacaaaccacaggatgccaggtga
tgaggcccttccttgagggaacagatgcgtctcagccaccctgtgtgctggatcccgctg
EXON 7  198 bp
ggatacgagacctcaaaacttcagcagtctcttctagaggggtctctagagggtctgact
cccaagcatcagcctcagaaccgggcagtcccgtcctttccttgggggtgcccagggcgg
aggagccgccggcatctccgatggtggtgagtgtgcgatccttcctccctctcccctcag
GGATTTACTGCTGCGGCTTGCTCCGCGCGCGGAAGAGTGACTGCACCGGCCTCCCACTGT
CCATGCTGACCAACCCAGCCACACCCCCGGCCCGGGGCCAGTACCAAATCAAGATGAAGG
GGAACATGTCCTTGATCTGCTGGTACAACAAAGGACACTTCCGCTTCCTGACCAACGCCT
ACTCCCCGGTGCAGCAGG
gtgagtgcgggtccgccattgacacagtggggcgcgcggggattggttgagcttggccga
gcccaccgctgcggtggatgtggcgtccactgtgggctgtgctgctctggggtcagacta
ccctcggttattccccagcatctggggccacgctcctaagtgtggcggctgtgtggaagc
EXON 8  106 bp
atccctctgaagcacctggtggttggtgctgattgttcttcttcaactcttccctcccct
cctcctcctctgctcattattaagttgggagcagctaagctggacgaagataggcacatt
tataaagtggcattaggaggaggtgctgaggaaggggcttatcttgtctctcgccttcag
GAGTCATCATCAAAAGGAAGAGTGGGGAGATCCCATGCCCCTTGGCCGTGGAGGCGTTTG
CCGCTCACCTGAGCTACATCTGCAGATACGATGACAAATACAGCAA
gtaagtggctgggcacctccatgacagaagggctctcatagttgtgccgtctcggaagag
atgtaatggcagatgatcactagtttccccagtgtaagaactgcaggatgaagaccctgg
gaggtaagatcctgccctcagcctgggcttctgggcctcgcctgtgcacacatggcttta
EXON 9  1975 bp
aaacccccagctggaactcacctaacatcccaagcctgactcctgcccccatagccctcc
tgcttctgtcgggggcgaacctgcagcgtctcacgggctgtggtgagggggggcctttgg
gatgcatctccgggtgccatgaaccatcgggtcagccgttcttattccctctgtcctcag
GTATTTCATTTCTCATAAACCAAACAAGACCTGGCAGCAGGTGTTCTGGTTCGCCATCAG
CATCGCCATCAACAATGCCTACATCCTGTACAAAATGTCAGACGCCTACCACGTGAAGAG
GTACAGCCGGGCGCAGTTTGGAGAGAGACTCGTCAGAGAGCTGCTGGGCTTGGAGGATGC
CTCTCCGACCCACTGATGCTGGGGGCGCAGGACTCGGTCAAGGGAGGGGCAAGAGGAGGA
GGAGAGCCTGCCGTTCCAACTTGCCCATCAGAGACCCGGACACGGCCTGGTGTGTGGCTT
GCTGCCTGGGAGGGATGCACAGGGCCTCTGGAGGGACAGGATGGACCTGGTCAGAGGACG
GTTGCTGTCCTCATTTGCATTCCAAGAAGAGCATGTCCTCCCTCGAGAAACAGTGCCGCC
GGTGTGATGAGCACTTACACCCACGTTCTCAAGGGCAGATTCTCTCATGACATCCGTGGA
GCTTGCGAGGCAGCGTGGACTGGTGACTGTGAAGGAAGGCCCCCGTGGTAGAATGAGCTG
GAGCACGCTCTAAGAGAGATGCCTGCTTCCTAAAGATCTACAGCAATCTGGGACGTGGTT
CAAGTTCAAGACTTGAAGGAAGCAAAGACGCCCTGCATGGTTACAATGGCTCAGGTGTCA
GGGGAGGCCGGAGGGTTTTCCAGCATTTGCCTCATGCCAGCACCTTTGAACCGGTCTCTT
AGAAGAAGACACACATCCTGGGTGTACAGTGGTGAAATGGGGAGTGGGTGCCCATTCTGA
AAAACGAGGCATTCCTGCTCATTCCCTCTGCTTAGCTGGTGGGCAGGGGAGAGAGGGAAA
TGCCAAAAACTTGGAGTGAAGGATGATGCTATTTTTTATTTTTAAATATATCTTCAGGTT
ATTTTCTTACTGTTGCTTCAGATCTAATGTAAAAGGCAGATGTCCCCTCCTCTCCACCCC
CGACGCTGACCCCGGCCTCAGTCACGGCTCTTTGCATGATCACAGTTCTGTGTTCTGGCC
TGTGGCAGGGCCGGGAAGGGCCGCTGGCTTCCGAACAGACGTGGTTGCTCTCCACGAGGC
GCATGGGGAGCCCGCGGGCCCTAAGCTTTGTCGCAGATGTCATCATTGGCAGAATTACTT
GTCTTGAAAAATAAGTAGCATTGCTGAAACACACAACCGAATTCTCTACGATGGCCATTT
GCTCATTGTCTTTCCTCTGTGTGTAGTGAGTGACCCTGGCAGTGTTTGCCTGCTCAGAGT
GGCCCCTCAGAACAACAGGGCTGGCCTTGGAAAAACCCCAAAACAGGACTGTGGTGACAA
CTCTGGTCAGGTGTGATTTGACATGAGGGCCGGAGGCGGTTGCTGACGGCAGGACTGGAG
AGGCTGCGTGCCCGGCACTGGCAGCGAGGCTCGTGTGTCCCCCAGGCAGATCTGGGCACT
TTCCCAACCCAGGTTTATGCGTCTCCAGGGAAGCCTCGGTGCCAGAGTGGTGGGCAGATC
TGACCATCCCCACAGACCAGAAACAAGGAATTTCTGGGATTACCCAGTCCCCCTTCAACC
CAGTTGATGTAACCACCTCATTTTTTACAAATACAGAATCTATTCTACTCAGGCTATGGG
CCTCGTCCTCACTCAGTTATTGCGAGTGTTGCTGTCCGCATGCTCCGGGCCCCACGTGGC
TCCTGTGCTCTAGATCATGGTGACTCCCCCGCCCTGTGGTTGGAATCGATGCCACGGATT
GCAGGCCAAATTTCAGATCGTGTTTCCAAACACCCTTGCTGTGCCCTTTAATGGGATTGA
AAGCACTTTTACCACATGGAGAAATATATTTTTAATTTGTGATGCTTTTCTACAAGGTCC
ACTATTTCTGAGTTTAATGTGTTTCCAACACTTAAGGAGACTCTAATGAAAGCTGATGAA
TTTTCTTTTCTGTCCAAACAAGTAAAATAAAAATAAAAGTCTATTTAGATGTTGA
ttctccgttaatacgtgaattcgtttaaaaggtcagggaacaggcggggtgcggtggctc
atgcctgtaatcccagcacttttggaggctgaagcgggcggatcgcttgagtccaggagt
ttgagaccagcattggcaacatggcgaaagcccatttctacaaaaaatacaagaattagg