Gene OSBPL9 Variant 6
DNA : 58.65 KbNT_032977
mRNA : 2742 bp NM_148905
CDS : 1677 bp NP_683703
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  304 bp
agctccctcggcctctccacccaaaactggcccaaccgccaatcgtctgcctctcacctc
ctacagcaggtgacccatggccaatcgccaggggtctctttgccaggagccgccagggcc
agccaatcggggcgacccctccgccggggaggggacgggaaaggggtggggggtgaaggg
GGTGAAGGGGGTGTCCCGGGGGACGGGCTGAACCTCAGTCAGGACCGCCTGCACCGCAGT
CCGGGGATCGGGTCGAGGGGAGAAGAAAAAGGGGTGCTCGGGAGCAGCCCCCGGCTACCT
CCCCTGGAGGCACAGAGGGCGGGGGCCTTGGCGAATGGCTTTCTTGCTGGCCACTTGCGG
AGTGAGTAGACCCCGAGGGTCTGGGAGAGGGGCCGGCCCCTACCCCTGAGTCCCCGGGGT
CCCGGCCGCCAGGCCGGAGCGCGAATGTCGTGCTCACCCTGCCTCCTTCCCGCCGCCCCC
TGGG
gtgagtaggacgacgtggctgcccgggcccctcttccttgggagttctcagttcctcagc
ctagatggggtggaggctgaggtcagggcctccagttccaccgagagggcattcgccccc
aaatgagactttggaggaggtctctttttttctattcatttttgtggaactctgttttcc
EXON 2  48 bp
caatagaatttgactttgattgagtgctcgaaaaaaaatacatgttgtcttgaaaataac
atataaatcatccctggacaaaatgtgtttaagaacaaatgtttgtttttctgtgtttag
tgaatgtacatcgtatagtaaagtggcttgatactataaccattttttaaaatcttgtag
CTTTTTGATGACAAGCTTCAAAACTGCAAAGAAGATGAACAGAGAAAG
gtaacttccataaccgtgcttttgacgttaaaaattttaaattcagccttttggagaaca
ctaagtatcttagtgtgtttttacttactataataatattattgacctagtgtaatatta
ctgccatatggacctcaagggtacttttctgataaatttctgttatggtttcataattaa
EXON 3  30 bp
acaaataattgatttagataaaaaacaaaatacaacaaaaagtactcccttcccaacttg
cttgtactcacttagaatgagtacattttggtaaaattctttaaatgactagccagtaaa
aaataaccgtccttctttgtgcttctgattatttctgtttaaacttattatttttcacag
AAAATTGAAACTCTCAAAGAGACAACAAAT
gtaagttatatgtttgatacattctgactttgcattagaaaatgttttaaaaagttattt
ctattttaagctgccactattgatgacagcaattgagatgttagtttttatgaatattat
acaggggtgcttaagcattgtatttttttttaaaggaatttaaaataatactaatagaat
EXON 4  51 bp
atgaataacttcatttggcattatcagcatactagaacccactagatccaaagaggatat
ttcttgtgtagtatagacttaaactctatacatctgaactgatttttatattttaagctt
taacattatatatccatttatttgagccaagatcctaaaatcagtgttttgtttttatag
AGCATGGTAGAATCAATTAAACACTGCATTGTGTTGCTGCAGATTGCCAAA
gtaagtaaattttactttcaattacctttgtgtatggagttcaaaaattataatggcgtt
tttctttaatagcaaaaaaactcagatctgaaacatagtacctttctacattaaactgta
ttgtgagcttattctatggaacaactgttgtgtttggctattatcttagctactgtttct
EXON 5  91 bp
tgctttaagcaactcttacacttctgtatagaaaaggtgtttcattccctcttttcattt
tgatcaacatatctatatagctaccctcaggattttgaagtcataaatgtgggcatttgg
gagggtagcatgagaagagcatttaattaaaaatagctatattgtgtttctttattttag
AGTACTATTAATCCCGTAGATGCAATATATCAACCTAGTCCTTTGGAACCTGTGATCAGC
ACAATGCCTTCCCAGACTGTGTTACCTCCAG
gtaatttgggaaaatgtttcttagattcattgatgagaaaaaaataatttgtgtggctgt
catagcagtcttagctattactgtttatttttgattttccttgtttttaataaaagcact
caaaaaataatacagccaaaagtgaactgaaaaaagatgataatgttttgatattggggc
EXON 6  105 bp
atcatcattgagtttaagaggctaggaagtcaaaaggaaggagtagcatggaactagact
taatgaaataaagtttcaaaaattactggcctttaggattttgaatcccagacaattaca
gtcaatagaatgtgtgtttggctgtttctgtaccttattttatacgttcaaatctcctag
AACCTGTTCAGTTGTGTAAGTCAGAGCAGCGTCCATCTTCCCTACCAGTTGGACCTGTGT
TGGCTACCTTGGGACATCATCAGACTCCTACACCAAATAGTACAG
gtacagatttgcataatttctttatgtctcataactctattaacatttgaggtttgtttg
tgacctctgatgaggagggggaaagttgaagaaatgtgttgtatattttctgttggagat
atgttagttttaacattatagttccatacatgaagtggttagctttgtgtttgaaagaga
EXON 7  160 bp
atcatgatttgccattttctgtgtggagtttaaatgttgattttctttataaatactgta
gcgacttttacaaacttaaccaaactcttttttgattttagaaaagtctgctttgactcc
atctccctagtttcttctctttcaccaatatttttctctaaaacccttttaacttcctag
GCAGTGGCCATTCACCACCGAGTAGCAGTCTCACTTCTCCAAGCCACGTGAACTTGTCTC
CAAATACAGTCCCAGAGTTCTCTTACTCCAGCAGTGAAGATGAATTTTATGATGCTGATG
AATTCCATCAAAGTGGCTCATCCCCAAAGCGCTTAATAGA
gtgagtagatgaacagaatatgtatttaaatgattctcctgatttttaaaaatctaattt
gattttgagactagtgttaatgacagacttgcctcatcagttattatttgggaaaattaa
aagggcaacctttttaatagaagtttttttattgatgtataatagttgtatggacaactt
EXON 8  113 bp
tatcaacatggctttgttgagcacatcctgtgcataaaggataagacaagagaccttgtc
atcaagagaattctaaagcatatatatgcatgcatgtaaccagctaactgtacgagtcta
gcttactatgattctaaattgctttctttagcttaaataaggtaattaatgtttttatag
TTCTTCTGGATCTGCCTCAGTCCTGACACACAGCAGCTCGGGAAATAGTCTAAAACGCCC
AGATACCACAGAATCACTTAATTCTTCCTTGTCCAATGGAACAAGTGATGCTG
gtaagtgacctttgataatttaacttttttttctttaaaaatatttgtggccagatgtgg
tggctcatgccgtaatcccagcactttgggagaccgaggtgggcagatcacttgaggtcc
ggagttcaagaccagcctgaccaacatggtgaaaccccatctctactaaaaaaatacaaa
EXON 9  119 bp
gaattgcttgaacctggaagatggaggtttacagtgagccaagatcgtgccattgcactc
cagcctgggcgaaagaatgagactccatctcaaacaaacaaacaaacaaaattgtaattc
tagtatcaggacagattggcccaatttagcaccattctaataagatctgctttattttag
ACCTGTTTGATTCACATGATGACAGAGATGATGATGCGGAGGCAGGGTCTGTGGAGGAGC
ACAAGAGCGTTATCATGCATCTCTTGTCGCAGGTTAGACTTGGAATGGATCTTACTAAG
gtaagaccaaatttgctgtaagtctgtgtgggtatgtatggattctcagtgattgcgtgg
tgagtgtgcctgcaaatgtagtaaaatgacataatttctttttatacctgtgtcttcttg
tgatttaatatagatgtagataagtaaacaaaattttataaatgatgaaataagtcaagc
EXON 10  86 bp
ggtcatttctgaatctgacaggttgagaattagtttttggagcatgcctgggcaatatgt
ggtggatgttaccatgatttgaatgaggtggtgttttgttttgttttctttttttttttt
ttagtctgtttatctgaagagaaatttgatcttcaagggtcaaatgtgtatgtttttcag
GTAGTTCTTCCAACGTTTATTCTTGAAAGAAGATCTCTTTTAGAAATGTATGCAGACTTT
TTTGCACATCCGGACCTGTTTGTGAG
gtatttgactgaacatggtagtttccaacgtttacagatgttactcagcagctttctgcc
ttttattttgcaggatagatggattccttgtcacctttcaaacatttctgggtattctgt
ggtattgaataatgtgtttacactggttgcctgtttgcttaaagttatatggtggcgatg
EXON 11  172 bp
agaccaatgcatttaattatatatattatactcaattttaaaatgaaactgtaagctaac
tcctggtcctaggtcctcagtcctctcagcctgacttaggtggaccatgctgggggttgt
tgcatcatcttgtcttgtaccagaaagcaggacattaaattttgtctttctcccttgcag
CATTAGTGACCAGAAGGATCCCAAGGATCGAATGGTTCAGGTTGTGAAATGGTACCTCTC
AGCCTTTCATGCGGGAAGGAAAGGATCAGTTGCCAAAAAGCCATACAATCCCATTTTGGG
CGAGATTTTTCAGTGTCATTGGACATTACCAAATGATACTGAAGAGAACACA
gtgagttctgcattgacatttttaaattatcttaattgtatactgattcaagattttatt
taggggcaaataataatgatgaaagcaatgatcaaaagatggtcaccacccatagaagaa
attgttgttagagcagcatagtttgaatgtagtgagaaggaggaaaaagagtaggatgag
EXON 12  85 bp
tagtctagtcagggagactgacacaaagcaattaaaatattgtagttaagttctacaata
gaaatatatatatagggtgcttggtgtgtgtagagcgagcagagaccccaattaccagat
tctctgaaatgtcatttgtgttttctcatcaaaagaaaattatgttatatttgcttgcag
GAACTAGTTTCAGAAGGACCAGTTCCCTGGGTTTCCAAAAACAGTGTAACATTTGTGGCT
GAGCAGGTTTCCCATCATCCACCCA
gtaagttacagagctcctctgcaacctgtgctctcaaaactattctgtctaaagagggtc
attaaaagcgccatagctgagggtactgtcagttgtgtgactagctgtgtgtttcttatt
ccctgaagtggaaactcaagttgatttgttcctcatatcttttccttttgtaagctccag
EXON 13  111 bp
gaatgaatgcttgcattggggaaaagggtataaaaggcaggtaggtacctcctggcgtaa
ttggaggctgtttgaagggtaaaggatttccccatgaagccaattatttccccaggttat
gtgattttggagaggtggctgtaggtatatataatctactaattgaaaatttctattcag
TTTCAGCCTTTTATGCTGAGTGTTTTAACAAGAAGATACAATTCAATGCTCATATCTGGA
CCAAATCAAAATTCCTTGGGATGTCAATTGGGGTGCACAACATAGGGCAGG
gtaagtgtgttggcattgggtggactacaatgttataggagaattttatgaaaatggcta
gactagatgtcattgttagcaactaagcattggtattgggggtgagagcaaagggtgggg
aactagataggttatccctaaattgaatggagtatcctggagtaaccatcagctcgacaa
EXON 14  64 bp
tagactagatgtcattgttagcaactaagcattggtattgggggtgagagcaaagggtgg
ggaactagataggttatccctaaattgaatggagtatcctggagtaaccatcagctcgac
aagaaagccttgtggccacttggcactactcatcagagattctgtcccttctctccacag
GCTGTGTCTCATGTCTAGACTATGATGAACATTACATTCTCACATTCCCCAATGGCTATG
GAAG
gcaagtgtgtccatttcctctgatcagcagtagactctgctgttccttgagacatgcccc
ttccccctcttcctcttaactgtcaaccttacctaaaaacttttgattttgcaggtctat
cctcacagtgccctgggtggaattaggaggagaatgcaatattaattgttccaaaacagg
EXON 15  141 bp
aggctgtgtctcatgtctagactatgatgaacattacattctcacattccccaatggcta
tggaaggcaagtgtgtccatttcctctgatcagcagtagactctgctgttccttgagaca
tgccccttccccctcttcctcttaactgtcaaccttacctaaaaacttttgattttgcag
GTCTATCCTCACAGTGCCCTGGGTGGAATTAGGAGGAGAATGCAATATTAATTGTTCCAA
AACAGGCTATAGTGCAAATATCATCTTCCACACTAAACCCTTCTATGGGGGCAAGAAGCA
CAGAATTACTGCCGAGATTTT
gtaggtattttttctgccttagagctcttatgcttttctgaaataactgccttttgtctt
gaactacagcttctggattaggagtgtgaaagaatggttctgtctttgtaagcgtgtttc
acattttatgtgtcatgtcttttgctgaagtcccatatcagaagaagacctaaaacatat
EXON 16  79 bp
cctgttgaaggccctcattcttatagttagccctggggagtccagttctgttaagatgct
ttcatcaaaaacttcacagttgctcttctgtgctctactctgtagttgggccacactgag
cagattctttggtagaattttcaacttgagactaacacaagtatttccttttctgttcag
TTCTCCAAATGACAAGAAGTCTTTTTGCTCAATTGAAGGGGAATGGAATGGTGTGATGTA
TGCAAAATATGCAACAGGG
gtaagatcctctattttgccacttgttttaggctacattagattgtactctatccctttt
tctggcttccttcattagtacttccttcataatgcatttccttctacagtatattagagc
tggaactttaggacagctccagtgtatgtcatctcttcagggcaagctttttctttcctt
EXON 17  92 bp
ctgtactactgcccactcagtgttcttaaacagaggaaagatgttatgaaattaacagga
ggagccagttaactgcattttggacctagagaatttgaagtgtcaaaagcactacaatgc
atctaacattaggttaggggtttatgggtctagttcccatccacctctattgttttctag
GAAAATACAGTCTTTGTAGATACCAAGAAGTTGCCTATAATCAAGAAGAAAGTGAGGAAG
TTGGAAGATCAGAACGAGTATGAATCCCGCAG
gtaagccgacattgttaagtggaactattgctgcagtgcttaaactttgcctaggcgtag
gcacagggctgggtttgagagacagtagggcagagcataatagtatagaccaagtttgaa
ttcctgggttcgtatgtcagaactaccacttactacctttgtgaccatggatggctcagt
EXON 18  136 bp
cagtggagtcttctgagcccatatgtctgttccttactccagtgccctggtgccagcgta
aggagatttagtctgtgacctacagcacttaaagccatttgacttgtattatactatatt
caggatggctgcaggctttcattctcaacattggcagctcctcttacctctttgttttag
CCTTTGGAAGGATGTCACTTTCAACTTAAAAATCAGAGACATTGATGCAGCAACTGAAGC
AAAGCACAGGCTTGAAGAAAGACAAAGAGCAGAAGCCCGAGAAAGGAAGGAGAAGGAAAT
TCAGTGGGAGACAAGG
gtaagcttgcctgccccaccctcctaagtgctgttcctcctaatttatttcagtgaatgt
tgaagaagtgatgtgccaaacactgtttataaacaagatgatcgctggtccctacttgaa
actcatttcagtctaatggcggggtggggagcagatatgaaatagtaagtatattacaga
EXON 19  755 bp
atttcagtgaatgttgaagaagtgatgtgccaaacactgtttataaacaagatgatcgct
ggtccctacttgaaactcatttcagtctaatggcggggtggggagcagatatgaaatagt
aagtatattacagaagtacaaagcaaatatgtaactaaattcttcctctttgtcttacag
TTATTTCATGAAGATGGAGAATGCTGGGTTTATGATGAACCATTACTGAAACGTCTTGGT
GCTGCCAAGCATTAGGTTGGAAGATGCAAAGTTTATACCTGATGATCAGGGCAGTAGGCA
TAATTCAGCAACAAACAATCTTCCTTTGGGAGAAACCTGTTCATTCCAATCTTCTAATTA
CAGTGGTTCCTATCTCAGGGATACTGGACTTTCTGACGCAGATGAACAATTAAGGGGAAA
AGCTTCCCTTTTCCCTCTGTGGCAGTTACGATTTTGACTTCAGTCCTGAGAAAAACTTCA
GGTTTTGAAAATCAGATGATGTCTTCTCCTTTTCCAAACACCACACGTTGAAAGCATTTA
TAAATCCAAGTCTGAAACTCTGCGCTCTAGTACTGCTGTTAAGATACACAACTTGTTTCT
TAGTTCATATAATCTCGGGATACACACACACACACACATATATATACACACACATACGTA
TACACACACATACATATATATAAATATACCTGATGCCAGATTTTTTTCATAAATATTCTG
CCTACTGTAAATATGGGTTCCTCTGAGTTGTTTTAGAAAATTAGCGCAATGTATTAAAAT
CAAGTGTTAGGAAATTTCATGGTCTTACCTACAATAACTTTTATTTTGGAATTGAACTAT
TATTAAATTGTATCTAATCCTGGATTACAGTTTAATTAATTATTCTTAGTGCTTAAGGCT
TCATAAAGTAATTTTTCCAACCTTTTTTTTAAAAA
tgtgcatcttttattatcttttatggttaaacttggaagccaattatttggcaaccttga
atacaagagctagcttttcaaagaaagacacttgaaataatggaggatccattcttttcc
tctgtcagattgtatgttctgtctttagcccctgccaggcaattccccagaatcttcact