Gene OSBPL9 Variant 3
DNA : 171.38 KbNT_032977
mRNA : 2871 bp NM_148908
CDS : 2172 bp NP_683706
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  130 bp
tctcgcatccgtggcatggagtcctacacacaataggcgccctaagaaagcgtgtttgac
ttgatcgctggagcatctgccggcaccgcccaggacccgcccaggacccgccccgccccc
tgcggccccgccccccgcatgctgaatgccatataggcgagtgacgtcaggccgtttgtt
GTCATTGGCGGCTCCCAAGATGGCGTCCATCATGGAAGGGCCGCTGAGCAAATGGACTAA
CGTGATGAAGGGCTGGCAGTACCGTTGGTTCGTGCTGGACTACAATGCAGGACTGCTCTC
CTACTACACG
gtgagtccttggagggcacagctccaggcgcctcggggccgcgtttcctgggtggaggtg
ggggaccggggttttaggtggctgagttgaggttgctagtctgggggtgccgccgtacgc
gagggttcccttgttggggagggttttacgtctcggatagccaatgagggtgagggagag
EXON 2  51 bp
tgacattttcatttaaaatctgtttattttcctatccataagtaatttctttttggaaga
gaaattggcagaagggatgggtattactgtaaatcttgtccttttatccccagatgattc
taaaaacaatttaccagtctgttaatgttttattcattgaatgctttgtttttcttttag
TCCAAGGACAAAATGATGAGAGGCTCTCGCAGAGGATGTGTTAGACTCAGA
gtgagtatttattcatttttatgaaaatcaattttgacagaagaaaattgtattctgata
gaattatggaagtctaaatttagtttagcttccttacataattgttggggcaggtatcta
agtctcagagagaaaatgtgatttctccaagtaactgttagtcagtatcagaaccaggac
EXON 3  79 bp
tgccagctcctctcctttagttctttctccttaagcaaaactagagtctcagtttcctct
tttctgtgtctagcctgcttccagtgtcgttggtgcattgagtattccagggctatagca
gtagtgaatattgctgatgtcattgtttgccttattgggattttgctctttgtttcacag
GGAGCTGTGATTGGTATAGACGATGAGGACGACAGCACCTTCACAATAACTGTTGATCAG
AAAACCTTCCATTTCCAGG
gtgagctgaaagaagagattctttctcttcatagtcccatctgcttcttttcttctcttt
tgggttgtttgctggatgacttgaatggttttgcaactgatcctgcatgaacgagtgcat
aggaacattctggatgaagtggtactgcaggttaggcagggatttgtatctgcaatggat
EXON 4  77 bp
tgttgcaagtagattgcatatctgtaaaaaatattaatagatcaagctgaacctattaag
gaaatggtacaactaaaaaccttttctgttagccatcatagttttaaaatgatattttca
aatatggagatatattatagaattaaacttttaattttaatgtataatcttttattccag
CCCGTGATGCTGATGAGCGAGAGAAGTGGATCCATGCCTTAGAAGAAACAATTCTTCGAC
ATACTCTCCAGCTTCAA
gtaagggtctttacatggtttccagatagttcattagttgttgctttctttttttgtctg
ttttctgttttttttttttaaataactgtggtatgatgtaataggaacttataatttctg
agttgcttatttttcctttacagttatagtaaagttatactcatttattttctcctgctt
EXON 5  96 bp
ggaagattgatgtaccactgtttaaatagacctaactgttaaatagacctattatttgtg
tcaaaatagaactgtattttaaaaattgaaatgtcttcatgtatgaagggaaaagtattt
tttgtactattaaactttgcttgggttctggtagatttattgcaaattctctttctctag
GGTTTGGATTCAGGATTTGTTCCTAGTGTCCAAGATTTTGATAAGAAACTTACAGAAGCT
GATGCTTACCTACAAATCTTGATTGAACAATTAAAG
gtatggcattagtttgtatattaaatttatataaatagaaaatgttactgagcttgattt
ttgagtaaaaacagttacttgatgttaatttacagccctcatgtggttcttcagcagttt
ttaaagcagacttaaaagatctagctgacttattcaaaggtctttatctctaattatatt
EXON 6  48 bp
caatagaatttgactttgattgagtgctcgaaaaaaaatacatgttgtcttgaaaataac
atataaatcatccctggacaaaatgtgtttaagaacaaatgtttgtttttctgtgtttag
tgaatgtacatcgtatagtaaagtggcttgatactataaccattttttaaaatcttgtag
CTTTTTGATGACAAGCTTCAAAACTGCAAAGAAGATGAACAGAGAAAG
gtaacttccataaccgtgcttttgacgttaaaaattttaaattcagccttttggagaaca
ctaagtatcttagtgtgtttttacttactataataatattattgacctagtgtaatatta
ctgccatatggacctcaagggtacttttctgataaatttctgttatggtttcataattaa
EXON 7  30 bp
acaaataattgatttagataaaaaacaaaatacaacaaaaagtactcccttcccaacttg
cttgtactcacttagaatgagtacattttggtaaaattctttaaatgactagccagtaaa
aaataaccgtccttctttgtgcttctgattatttctgtttaaacttattatttttcacag
AAAATTGAAACTCTCAAAGAGACAACAAAT
gtaagttatatgtttgatacattctgactttgcattagaaaatgttttaaaaagttattt
ctattttaagctgccactattgatgacagcaattgagatgttagtttttatgaatattat
acaggggtgcttaagcattgtatttttttttaaaggaatttaaaataatactaatagaat
EXON 8  51 bp
atgaataacttcatttggcattatcagcatactagaacccactagatccaaagaggatat
ttcttgtgtagtatagacttaaactctatacatctgaactgatttttatattttaagctt
taacattatatatccatttatttgagccaagatcctaaaatcagtgttttgtttttatag
AGCATGGTAGAATCAATTAAACACTGCATTGTGTTGCTGCAGATTGCCAAA
gtaagtaaattttactttcaattacctttgtgtatggagttcaaaaattataatggcgtt
tttctttaatagcaaaaaaactcagatctgaaacatagtacctttctacattaaactgta
ttgtgagcttattctatggaacaactgttgtgtttggctattatcttagctactgtttct
EXON 9  91 bp
tgctttaagcaactcttacacttctgtatagaaaaggtgtttcattccctcttttcattt
tgatcaacatatctatatagctaccctcaggattttgaagtcataaatgtgggcatttgg
gagggtagcatgagaagagcatttaattaaaaatagctatattgtgtttctttattttag
AGTACTATTAATCCCGTAGATGCAATATATCAACCTAGTCCTTTGGAACCTGTGATCAGC
ACAATGCCTTCCCAGACTGTGTTACCTCCAG
gtaatttgggaaaatgtttcttagattcattgatgagaaaaaaataatttgtgtggctgt
catagcagtcttagctattactgtttatttttgattttccttgtttttaataaaagcact
caaaaaataatacagccaaaagtgaactgaaaaaagatgataatgttttgatattggggc
EXON 10  105 bp
atcatcattgagtttaagaggctaggaagtcaaaaggaaggagtagcatggaactagact
taatgaaataaagtttcaaaaattactggcctttaggattttgaatcccagacaattaca
gtcaatagaatgtgtgtttggctgtttctgtaccttattttatacgttcaaatctcctag
AACCTGTTCAGTTGTGTAAGTCAGAGCAGCGTCCATCTTCCCTACCAGTTGGACCTGTGT
TGGCTACCTTGGGACATCATCAGACTCCTACACCAAATAGTACAG
gtacagatttgcataatttctttatgtctcataactctattaacatttgaggtttgtttg
tgacctctgatgaggagggggaaagttgaagaaatgtgttgtatattttctgttggagat
atgttagttttaacattatagttccatacatgaagtggttagctttgtgtttgaaagaga
EXON 11  160 bp
atcatgatttgccattttctgtgtggagtttaaatgttgattttctttataaatactgta
gcgacttttacaaacttaaccaaactcttttttgattttagaaaagtctgctttgactcc
atctccctagtttcttctctttcaccaatatttttctctaaaacccttttaacttcctag
GCAGTGGCCATTCACCACCGAGTAGCAGTCTCACTTCTCCAAGCCACGTGAACTTGTCTC
CAAATACAGTCCCAGAGTTCTCTTACTCCAGCAGTGAAGATGAATTTTATGATGCTGATG
AATTCCATCAAAGTGGCTCATCCCCAAAGCGCTTAATAGA
gtgagtagatgaacagaatatgtatttaaatgattctcctgatttttaaaaatctaattt
gattttgagactagtgttaatgacagacttgcctcatcagttattatttgggaaaattaa
aagggcaacctttttaatagaagtttttttattgatgtataatagttgtatggacaactt
EXON 12  113 bp
tatcaacatggctttgttgagcacatcctgtgcataaaggataagacaagagaccttgtc
atcaagagaattctaaagcatatatatgcatgcatgtaaccagctaactgtacgagtcta
gcttactatgattctaaattgctttctttagcttaaataaggtaattaatgtttttatag
TTCTTCTGGATCTGCCTCAGTCCTGACACACAGCAGCTCGGGAAATAGTCTAAAACGCCC
AGATACCACAGAATCACTTAATTCTTCCTTGTCCAATGGAACAAGTGATGCTG
gtaagtgacctttgataatttaacttttttttctttaaaaatatttgtggccagatgtgg
tggctcatgccgtaatcccagcactttgggagaccgaggtgggcagatcacttgaggtcc
ggagttcaagaccagcctgaccaacatggtgaaaccccatctctactaaaaaaatacaaa
EXON 13  119 bp
gaattgcttgaacctggaagatggaggtttacagtgagccaagatcgtgccattgcactc
cagcctgggcgaaagaatgagactccatctcaaacaaacaaacaaacaaaattgtaattc
tagtatcaggacagattggcccaatttagcaccattctaataagatctgctttattttag
ACCTGTTTGATTCACATGATGACAGAGATGATGATGCGGAGGCAGGGTCTGTGGAGGAGC
ACAAGAGCGTTATCATGCATCTCTTGTCGCAGGTTAGACTTGGAATGGATCTTACTAAG
gtaagaccaaatttgctgtaagtctgtgtgggtatgtatggattctcagtgattgcgtgg
tgagtgtgcctgcaaatgtagtaaaatgacataatttctttttatacctgtgtcttcttg
tgatttaatatagatgtagataagtaaacaaaattttataaatgatgaaataagtcaagc
EXON 14  86 bp
ggtcatttctgaatctgacaggttgagaattagtttttggagcatgcctgggcaatatgt
ggtggatgttaccatgatttgaatgaggtggtgttttgttttgttttctttttttttttt
ttagtctgtttatctgaagagaaatttgatcttcaagggtcaaatgtgtatgtttttcag
GTAGTTCTTCCAACGTTTATTCTTGAAAGAAGATCTCTTTTAGAAATGTATGCAGACTTT
TTTGCACATCCGGACCTGTTTGTGAG
gtatttgactgaacatggtagtttccaacgtttacagatgttactcagcagctttctgcc
ttttattttgcaggatagatggattccttgtcacctttcaaacatttctgggtattctgt
ggtattgaataatgtgtttacactggttgcctgtttgcttaaagttatatggtggcgatg
EXON 15  172 bp
agaccaatgcatttaattatatatattatactcaattttaaaatgaaactgtaagctaac
tcctggtcctaggtcctcagtcctctcagcctgacttaggtggaccatgctgggggttgt
tgcatcatcttgtcttgtaccagaaagcaggacattaaattttgtctttctcccttgcag
CATTAGTGACCAGAAGGATCCCAAGGATCGAATGGTTCAGGTTGTGAAATGGTACCTCTC
AGCCTTTCATGCGGGAAGGAAAGGATCAGTTGCCAAAAAGCCATACAATCCCATTTTGGG
CGAGATTTTTCAGTGTCATTGGACATTACCAAATGATACTGAAGAGAACACA
gtgagttctgcattgacatttttaaattatcttaattgtatactgattcaagattttatt
taggggcaaataataatgatgaaagcaatgatcaaaagatggtcaccacccatagaagaa
attgttgttagagcagcatagtttgaatgtagtgagaaggaggaaaaagagtaggatgag
EXON 16  85 bp
tagtctagtcagggagactgacacaaagcaattaaaatattgtagttaagttctacaata
gaaatatatatatagggtgcttggtgtgtgtagagcgagcagagaccccaattaccagat
tctctgaaatgtcatttgtgttttctcatcaaaagaaaattatgttatatttgcttgcag
GAACTAGTTTCAGAAGGACCAGTTCCCTGGGTTTCCAAAAACAGTGTAACATTTGTGGCT
GAGCAGGTTTCCCATCATCCACCCA
gtaagttacagagctcctctgcaacctgtgctctcaaaactattctgtctaaagagggtc
attaaaagcgccatagctgagggtactgtcagttgtgtgactagctgtgtgtttcttatt
ccctgaagtggaaactcaagttgatttgttcctcatatcttttccttttgtaagctccag
EXON 17  111 bp
gaatgaatgcttgcattggggaaaagggtataaaaggcaggtaggtacctcctggcgtaa
ttggaggctgtttgaagggtaaaggatttccccatgaagccaattatttccccaggttat
gtgattttggagaggtggctgtaggtatatataatctactaattgaaaatttctattcag
TTTCAGCCTTTTATGCTGAGTGTTTTAACAAGAAGATACAATTCAATGCTCATATCTGGA
CCAAATCAAAATTCCTTGGGATGTCAATTGGGGTGCACAACATAGGGCAGG
gtaagtgtgttggcattgggtggactacaatgttataggagaattttatgaaaatggcta
gactagatgtcattgttagcaactaagcattggtattgggggtgagagcaaagggtgggg
aactagataggttatccctaaattgaatggagtatcctggagtaaccatcagctcgacaa
EXON 18  64 bp
tagactagatgtcattgttagcaactaagcattggtattgggggtgagagcaaagggtgg
ggaactagataggttatccctaaattgaatggagtatcctggagtaaccatcagctcgac
aagaaagccttgtggccacttggcactactcatcagagattctgtcccttctctccacag
GCTGTGTCTCATGTCTAGACTATGATGAACATTACATTCTCACATTCCCCAATGGCTATG
GAAG
gcaagtgtgtccatttcctctgatcagcagtagactctgctgttccttgagacatgcccc
ttccccctcttcctcttaactgtcaaccttacctaaaaacttttgattttgcaggtctat
cctcacagtgccctgggtggaattaggaggagaatgcaatattaattgttccaaaacagg
EXON 19  141 bp
aggctgtgtctcatgtctagactatgatgaacattacattctcacattccccaatggcta
tggaaggcaagtgtgtccatttcctctgatcagcagtagactctgctgttccttgagaca
tgccccttccccctcttcctcttaactgtcaaccttacctaaaaacttttgattttgcag
GTCTATCCTCACAGTGCCCTGGGTGGAATTAGGAGGAGAATGCAATATTAATTGTTCCAA
AACAGGCTATAGTGCAAATATCATCTTCCACACTAAACCCTTCTATGGGGGCAAGAAGCA
CAGAATTACTGCCGAGATTTT
gtaggtattttttctgccttagagctcttatgcttttctgaaataactgccttttgtctt
gaactacagcttctggattaggagtgtgaaagaatggttctgtctttgtaagcgtgtttc
acattttatgtgtcatgtcttttgctgaagtcccatatcagaagaagacctaaaacatat
EXON 20  79 bp
cctgttgaaggccctcattcttatagttagccctggggagtccagttctgttaagatgct
ttcatcaaaaacttcacagttgctcttctgtgctctactctgtagttgggccacactgag
cagattctttggtagaattttcaacttgagactaacacaagtatttccttttctgttcag
TTCTCCAAATGACAAGAAGTCTTTTTGCTCAATTGAAGGGGAATGGAATGGTGTGATGTA
TGCAAAATATGCAACAGGG
gtaagatcctctattttgccacttgttttaggctacattagattgtactctatccctttt
tctggcttccttcattagtacttccttcataatgcatttccttctacagtatattagagc
tggaactttaggacagctccagtgtatgtcatctcttcagggcaagctttttctttcctt
EXON 21  92 bp
ctgtactactgcccactcagtgttcttaaacagaggaaagatgttatgaaattaacagga
ggagccagttaactgcattttggacctagagaatttgaagtgtcaaaagcactacaatgc
atctaacattaggttaggggtttatgggtctagttcccatccacctctattgttttctag
GAAAATACAGTCTTTGTAGATACCAAGAAGTTGCCTATAATCAAGAAGAAAGTGAGGAAG
TTGGAAGATCAGAACGAGTATGAATCCCGCAG
gtaagccgacattgttaagtggaactattgctgcagtgcttaaactttgcctaggcgtag
gcacagggctgggtttgagagacagtagggcagagcataatagtatagaccaagtttgaa
ttcctgggttcgtatgtcagaactaccacttactacctttgtgaccatggatggctcagt
EXON 22  136 bp
cagtggagtcttctgagcccatatgtctgttccttactccagtgccctggtgccagcgta
aggagatttagtctgtgacctacagcacttaaagccatttgacttgtattatactatatt
caggatggctgcaggctttcattctcaacattggcagctcctcttacctctttgttttag
CCTTTGGAAGGATGTCACTTTCAACTTAAAAATCAGAGACATTGATGCAGCAACTGAAGC
AAAGCACAGGCTTGAAGAAAGACAAAGAGCAGAAGCCCGAGAAAGGAAGGAGAAGGAAAT
TCAGTGGGAGACAAGG
gtaagcttgcctgccccaccctcctaagtgctgttcctcctaatttatttcagtgaatgt
tgaagaagtgatgtgccaaacactgtttataaacaagatgatcgctggtccctacttgaa
actcatttcagtctaatggcggggtggggagcagatatgaaatagtaagtatattacaga
EXON 23  755 bp
atttcagtgaatgttgaagaagtgatgtgccaaacactgtttataaacaagatgatcgct
ggtccctacttgaaactcatttcagtctaatggcggggtggggagcagatatgaaatagt
aagtatattacagaagtacaaagcaaatatgtaactaaattcttcctctttgtcttacag
TTATTTCATGAAGATGGAGAATGCTGGGTTTATGATGAACCATTACTGAAACGTCTTGGT
GCTGCCAAGCATTAGGTTGGAAGATGCAAAGTTTATACCTGATGATCAGGGCAGTAGGCA
TAATTCAGCAACAAACAATCTTCCTTTGGGAGAAACCTGTTCATTCCAATCTTCTAATTA
CAGTGGTTCCTATCTCAGGGATACTGGACTTTCTGACGCAGATGAACAATTAAGGGGAAA
AGCTTCCCTTTTCCCTCTGTGGCAGTTACGATTTTGACTTCAGTCCTGAGAAAAACTTCA
GGTTTTGAAAATCAGATGATGTCTTCTCCTTTTCCAAACACCACACGTTGAAAGCATTTA
TAAATCCAAGTCTGAAACTCTGCGCTCTAGTACTGCTGTTAAGATACACAACTTGTTTCT
TAGTTCATATAATCTCGGGATACACACACACACACACATATATATACACACACATACGTA
TACACACACATACATATATATAAATATACCTGATGCCAGATTTTTTTCATAAATATTCTG
CCTACTGTAAATATGGGTTCCTCTGAGTTGTTTTAGAAAATTAGCGCAATGTATTAAAAT
CAAGTGTTAGGAAATTTCATGGTCTTACCTACAATAACTTTTATTTTGGAATTGAACTAT
TATTAAATTGTATCTAATCCTGGATTACAGTTTAATTAATTATTCTTAGTGCTTAAGGCT
TCATAAAGTAATTTTTCCAACCTTTTTTTTAAAAA
tgtgcatcttttattatcttttatggttaaacttggaagccaattatttggcaaccttga
atacaagagctagcttttcaaagaaagacacttgaaataatggaggatccattcttttcc
tctgtcagattgtatgttctgtctttagcccctgccaggcaattccccagaatcttcact