Gene NR0B2 Variant 1
DNA : 2.48 KbNT_037485
mRNA : 1160 bp NM_021969
CDS : 774 bp NP_068804
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  561 bp
tgccacgtggggttcccaatgccccctcccccaccacttccccaccattcctgccagggg
caatgtctgtgtgtttttttcaatgaacatgacttctggagtcaaggttgttgggccatt
ccccccgttccactcactgggaatataaatagcacccacagcgcagaacacagagccaga
GAGCTGGAAGTGAGAGCAGATCCCTAACCATGAGCACCAGCCAACCAGGGGCCTGCCCAT
GCCAGGGAGCTGCAAGCCGCCCCGCCATTCTCTACGCACTTCTGAGCTCCAGCCTCAAGG
CTGTCCCCCGACCCCGTAGCCGCTGCCTATGTAGGCAGCACCGGCCCGTCCAGCTATGTG
CACCTCATCGCACCTGCCGGGAGGCCTTGGATGTTCTGGCCAAGACAGTGGCCTTCCTCA
GGAACCTGCCATCCTTCTGGCAGCTGCCTCCCCAGGACCAGCGGCGGCTGCTGCAGGGTT
GCTGGGGCCCCCTCTTCCTGCTTGGGTTGGCCCAAGATGCTGTGACCTTTGAGGTGGCTG
AGGCCCCGGTGCCCAGCATACTCAAGAAGATTCTGCTGGAGGAGCCCAGCAGCAGTGGAG
GCAGTGGCCAACTGCCAGACAGACCCCAGCCCTCCCTGGCTGCGGTGCAGTGGCTTCAAT
GCTGTCTGGAGTCCTTCTGGAGCCTGGAGCTTAGCCCCAAGGAATATGCCTGCCTGAAAG
GGACCATCCTCTTCAACCCCG
gtgagctcccagacactcctgggtggggggcaaggctgaagcaggggccagccagggaag
gtagcttctaagggtttgatatctgttatctcattgggtcctcattttctttttattttt
ctgagacagagtctcactctgtcacccagtctggagtgcagtggtgcgatcttggctcac
EXON 2  599 bp
atacattgaaaattgataaataaattacctcctctaaaggaggaggtagtagtgggacct
caaaggccgagcaaaggaggcagaggggtgtctctgatggcccagatcttgggccagtct
tgtcctttggtggctgggagtagggtgctcaccagccctcttctccctctctgcccacag
ATGTGCCAGGCCTCCAAGCCGCCTCCCACATTGGGCACCTGCAGCAGGAGGCTCACTGGG
TGCTGTGTGAAGTCCTGGAACCCTGGTGCCCAGCAGCCCAAGGCCGCCTGACCCGTGTCC
TCCTCACGGCCTCCACCCTCAAGTCCATTCCGACCAGCCTGCTTGGGGACCTCTTCTTTC
GCCCTATCATTGGAGATGTTGACATCGCTGGCCTTCTTGGGGACATGCTTTTGCTCAGGT
GACCTGTTCCAGCCCAGGCAGAGATCAGGTGGGCAGAGGCTGGCAGTGCTGATTCAGCCT
GGCCATCCCCAGAGGTGACCCAATGCTCCTGGAGGGGGCAAGCCTGTATAGACAGCACTT
GGCTCCTTAGGAACAGCTCTTCACTCAGCCACACCCCACATTGGACTTCCTTGGTTTGGA
CACAGTGTTCCAGCTGCCTGGGAGGCTTTTGGTGGTCCCCACAGCCTCTGGGCCAAGACT
CCTGTCCCTTCTTGGGATGAGAATGAAAGCTTAGGCTGCTTATTGGACCAGAAGTCCTAT
CGACTTTATACAGAACTGAATTAAGTTATTGATTTTTGTAATAAAAGGTATGAAACACT
tggagcctgatactgtcatttgtgcatatggaagggactgtctcacctccagggcccacc
ctgctgctatcagaggtagcccaagggaaaaaatccacagggttgctggagctaattttc
cagggaacagtatcagttcacaatcccatcacctcattgtctttatcctcaggggaagga