Gene NPPB Variant 1
DNA : 1.46 KbNT_021937
mRNA : 691 bp NM_002521
CDS : 405 bp NP_002512
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  230 bp
gctctgcccggtctccacctcccacgtcgcaggcgcggaggggctcattcccgggccctg
atctcagaggcccggaatgtggctgataaatcagagataaccctgcatggcagggcaggc
ccgacactcagctccaggataaaaggccacggtgtcccgaggagccaggaggagcacccc
GCAGGCTGAGGGCAGGTGGGAAGCAAACCCGGACGCATCGCAGCAGCAGCAGCAGCAGCA
GAAGCAGCAGCAGCAGCCTCCGCAGTCCCTCCAGAGACATGGATCCCCAGACAGCACCTT
CCCGGGCGCTCCTGCTCCTGCTCTTCTTGCATCTGGCTTTCCTGGGAGGTCGTTCCCACC
CGCTGGGCAGCCCCGGTTCAGCCTCGGACTTGGAAACGTCCGGGTTACAG
gtgagagcggagggcagctcagggggattggacagcagcaatgaaagggtcctcacctgc
tgtcccaagaggccctcatctttcctttggaattagtgataaaggaatcagaaaatggag
agactgggtgccctgaccctgtacccaaggcagtcggttcacttgggtgccatgaagggc
EXON 2  256 bp
tcacctgctgtcccaagaggccctcatctttcctttggaattagtgataaaggaatcaga
aaatggagagactgggtgccctgaccctgtacccaaggcagtcggttcacttgggtgcca
tgaagggctggtgagcccaggggtgggtccctgaggcttggacgcccccattcattgcag
GAGCAGCGCAACCATTTGCAGGGCAAACTGTCGGAGCTGCAGGTGGAGCAGACATCCCTG
GAGCCCCTCCAGGAGAGCCCCCGTCCCACAGGTGTCTGGAAGTCCCGGGAGGTAGCCACC
GAGGGCATCCGTGGGCACCGCAAAATGGTCCTCTACACCCTGCGGGCACCACGAAGCCCC
AAGATGGTGCAAGGGTCTGGCTGCTTTGGGAGGAAGATGGACCGGATCAGCTCCTCCAGT
GGCCTGGGCTGCAAAG
gtaagcaccccctgccaccccggccgccttcccccattccagtgtgtgacactgttagag
tcactttggggtttgttgtctctgggaaccacactctttgagaaaaggtcacctggacat
cgcttcctcttgttaacagccttcagggccaaggggtgcctttgtggaattagtaaatgt
EXON 3  205 bp
gatcaccagagcaatgataatccccaatttacagatgaggaaactgaggctcagagagtt
gcattaagcctcaaacgtctgatgactaacagggtggtgggtggcacacgatgaggtaag
ctcagcccctgcctccatctcccaccctaaccatcatcaccctctctctttccctgacag
TGCTGAGGCGGCATTAAGAGGAAGTCCTGGCTGCAGACACCTGCTTCTGATTCCACAAGG
GGCTTTTTCCTCAACCCTGTGGCCGCCTTTGAAGTGACTCATTTTTTTAATGTATTTATG
TATTTATTTGATTGTTTTATATAAGATGGTTTCTTACCTTTGAGCACAAAATTTCCACGG
TGAAATAAAGTCAACATTATAAGCT
ttatcttttgaaactgatttgtcttggcgcattaaaaataatccctcatttcaaagaaac
caacccaactaaaaccacaaagccctgtgatctcaaggcatcttcatggtgggatgagga
tgtggcctcagaggtagcaggctttcttttctttcagagtttttaatgctctgaaatgtt