Gene MED8 Variant 1
DNA : 4.51 KbNT_032977
mRNA : 1428 bp NM_052877
CDS : 639 bp NP_443109
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  114 bp
gttgatgctgtctataacccaaataccaaagatagaaaacaacctggctatcctatgcca
atgagatcctgtgttacctgactggtgttgcacaccatctccttggctttccagccctcc
tttctatgtgtcatactcgtttatctgggtgaccaacctgttcctattggtgcagagaga
GGAGAAGCAGCTTGAGGCATCATTAGATGCACTGCTGAGTCAAGTGGCTGATCTGAAGAA
CTCTCTGGGGAGTTTCATTTGCAAGTTGGAGAACGAGTATGGCCGGCTGACCTG
gtaagagttaccagggcaagctaggaagggcttatgggtgggggggcctagcctcctgat
gaataggacatttctaatgatgtaaccatttatcagtttgcaaacatcttttgatttgga
aagagctgggtttcctaacatttagcaagtggattccatggcaaggaagtagagaaatgc
EXON 2  145 bp
atgtccctctttcatagccctgtcatccctgttagtctgttcccacttaggctagtcata
gggctatgagacttttggaggtgaatccaagtgttcctagcctgaaggaactaggactat
tttactaagaaccacccagggaaggggtacaacattcttacaccttgttaccaccaccag
GCCATCTGTCCTGGACAGCTTTGCCTTGCTTTCTGGACAGCTGAACACTCTGAACAAGGT
CTTGAAGCATGAAAAAACACCGCTGTTCCGTAACCAGGTCATCATTCCTCTGGTGTTGTC
TCCAGACCGAGATGAAGATCTCATG
gtaagaggagaaaaagaatacaacttgggaaattaaggggttttttaggcttctttagta
tttagggaaattaagttattagctgagagcctagaaataattttggaggccttgcttttt
gttcttctgaaggcgggagagccactcccaaatagtgctgtaataacctgaggggtatgt
EXON 3  141 bp
agaagacacaaaaaatgaaggatggagtaaaggagagtgtgtcctagcaaactagatatt
atgtctcaggttgtattttccttgaaaatgcactgtttgcctgtggatgggactttatgt
caggccagatagaatcttcttggagtacagagtaggatcaataaaatctgtgtgttacag
CGGCAGACTGAAGGACGGGTGCCTGTTTTCAGCCATGAGGTAGTCCCTGACCATCTGAGA
ACCAAGCCTGACCCTGAAGTGGAAGAACAGGAGAAGCAACTGACGACAGATGCTGCCCGC
ATTGGTGCAGATGCAGCCCAG
gttggactgagtcactgccttgctgccccatccccatcccatcatgagaagctaggcatt
accattcctgtctagtagggatacatagttggttgcgcctaagttgcttctggcagaacc
caaggaataaatttctccatatcgtttcctagttaccctaatctctgcacaaatttgtgt
EXON 4  82 bp
tgagtcactgccttgctgccccatccccatcccatcatgagaagctaggcattaccattc
ctgtctagtagggatacatagttggttgcgcctaagttgcttctggcagaacccaaggaa
taaatttctccatatcgtttcctagttaccctaatctctgcacaaatttgtgtgttacag
AAGCAGATCCAGAGCTTGAATAAAATGTGTTCAAACCTTCTGGAGAAAATCAGCAAAGAG
GAGCGAGAATCAGAGAGTGGAG
gtatgatgggactggtggctaaacagagaaggagaggtatataagatcactggaatggga
atggttgttttggaagtagtgaagttaggacacaagggtgaactgctttggggtttgtat
ccattctgttagccttttgtatttaaggccagcactgaagcagtggaggaaatgggcaaa
EXON 5  249 bp
aagaagagagaattctgagataggcttgggggtcctctggctctttttctgggctgtgag
ggagtctagatgttgctgaattcagaactccaaaccctggcactcatactggtcttccag
ctgccacgttcagtcctgcatcagaagcatacttcaggatccccattactttttcttcag
GTCTCCGGCCGAACAAGCAGACCTTTAACCCTACAGACACTAATGCCTTGGTGGCAGCTG
TTGCCTTTGGGAAAGGACTATCTAATTGGAGACCTTCAGGCAGCAGTGGTCCTGGCCAGG
CAGGCCAGCCAGGAGCTGGGACGATCCTTGCAGGAACCTCAGGATTACAGCAGGTGCAGA
TGGCAGGAGCTCCAAGCCAGCAGCAGCCAATGCTCAGTGGGGTACAAATGGCTCAGGCAG
GTCAACCAG
gtaaggtggcaggggttgaaatgaagctgactttgagcaggagtgggagggaataagcta
gattatctgggcctccagcatctctagacctagaggttttctctatttctccttttcact
gtgacccaggaaataattttcagaagtaaaaaaatctcatctgagactctgcaacaggca
EXON 6  61 bp
caccttcagggagacagctgggtgaagaatcatacttctgacctctgtcaaacagggtca
gatgccgcagaggttctgagatgataaaggaagtgacagagggaacctgaggtaccacat
ttctgatttgtcatgaaagtcttaccttgcttaagatgacttttttaatgttcctttcag
GGAAAATGCCAAGTGGAATAAAAACCAACATCAAGTCGGCTTCCATGCATCCCTACCAGC
G
gtgagtgtggctggcaacctcgactccctggtgctctttgcagagttgggcagtgaaatt
accttttgctcaaggctcacctagatgggtacaataaaaagaacatgggctttcagcagc
agacaaatcccacttccaccactgactagctgtgtgaccttggacaagtgacctaatttt
EXON 7  636 bp
ttctacagatccttctccccaccaccctccacagtccttgatccagaacttaccctaatc
tgatactgcctcacgtcaatggtgagctgatggacacaagatcaaataaggctatgctta
ttttgtgctgccagaaactgtagcaacctctgtgttcttagaggcacactgtttttgcag
GCCCTCCTGCCTGGGTTTCATTCTGGCTATCCCTCTAAGGCGCAAGGTGAAGAAGCTTCT
GGGCCAGGAAGGAAAAAAAAATGCCCACCTGCAGCTCTGGTGAAGCTTGGGCCTGCTCTC
CTTTCCATCCTCTAAGGAGCCAACTTGGCTTTTACCTGTCAAATAGTCATAAAGTCCCCT
ATCCTTTACCCCACCTTATACACACGAGGCTTTCTCAGGAAGTGGCTCTGCCAGGCAGGA
CTATGTGGGAAAGGGTTTTTCCTTAGCACACGAAAAAGCCCCTTCCCCTGGATTCATGTT
TCTTATTTTGGAGGGAGAAGGGAATTGCACTTCACACTGCCATCAGGGTTTAGTTGACCT
CATAATGGTGCCCACTTTCTCGACTTTGGCCAGGATTTCCTTCAAAGAAAACGACTTTCC
TTCATTTCCCTAAGCCTGTGGCCCAAATGGTGGACCAGAATGATGGTGGGAGGGGGCAAC
CCCCAGTAGCTTTGCCTGCTTTTATAAAGTTGAACAAATTGAATTTAGACATTCAGGCTA
ACCTGCCTTTCTTAGTACTCCTTTGTTGGCATGGGCAGGGGTTGAGTCAGCAGAAGTGGA
CCAAAGGATTCCTCTGAATAAAGTTATTTAAATTGA
tgttcactggctcagggttgtctgacagtaatttatgagagcactacatagggatcagag
gggcagtttcaagagtgctgcaaggcagttctaatttgttctccataaaaaagtttccgt
atctttaattagctttgatctaaaaatcctgaaacttccctcctgctcataccttccagc