Gene LOR Variant 1
DNA : 2.40 KbNT_032962
mRNA : 1206 bp NM_000427
CDS : 591 bp NP_000418
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  10 bp
aatgggccatcctgtgcctgcaatcacagggaggtggggccgacagccacgggtcacgta
actgaggccaaacacaagaagctggcctggatcaatgagtcagggagagctctatatata
acctcaggagatcagtgctcctcacattgccagcatcttctctcctcactcacccttcct
GGTGCTTTGG
gtaagtgtggttctactgactctctcattttcccagctggtcttgcccaggcctgactag
attagatggaccagggcctctttcccctttgggagctataggacctctgccttcccaaaa
gcactcacatttagagggcggtcaggaaaggagcaggggatgagctgctgccatgcagat
EXON 2  1196 bp
ttctgcaggggaatgaggaactcaacttttccaaaagcagcaatcataagaaaccccgct
gagggctctccgggcacctgaaggagccctgggaggatggcgatgttgcctatggatgca
gctgcctccgtaagtatcctcttgcagctggtccagcgatgctctcttctccccttccag
GCTCTCCTTCCTTCTCAGACAAGATGTCTTATCAGAAAAAGCAGCCCACCCCTCAGCCCC
CAGTGGACTGCGTGAAGACCTCTGGCGGCGGTGGCGGTGGCGGCGGCAGCGGCGGTGGTG
GCTGCGGCTTCTTCGGCGGCGGCGGCTCAGGGGGCGGTAGCAGCGGTTCTGGCTGCGGCT
ACTCCGGCGGCGGTGGCTACTCTGGCGGCGGCTGCGGCGGGGGCTCCTCCGGCGGCGGGG
GCGGGGGCGGCATTGGAGGCTGCGGAGGGGGCTCCGGTGGGAGCGTCAAGTACTCCGGAG
GCGGCGGCTCCTCCGGCGGGGGCTCTGGCTGTTTCTCCAGCGGTGGGGGCGGCTCCGGCT
GCTTCTCCTCCGGTGGCGGCGGCTCCTCCGGGGGCGGCTCCGGCTGCTTCTCCAGCGGTG
GGGGCGGCTCCTCCGGGGGCGGCTCCGGCTGCTTCTCCTCCGGCGGCGGCGGCTTCTCGG
GCCAGGCGGTCCAGTGCCAGAGCTACGGAGGCGTCTCTAGCGGCGGCTCCTCCGGGGGCG
GCTCCGGCTGCTTCTCCAGCGGCGGGGGCGGCGGCTCTGTCTGCGGCTACTCTGGCGGCG
GCTCTGGCTGCGGCGGAGGCTCCTCTGGCGGCAGCGGCTCCGGCTACGTCTCCTCGCAGC
AGGTCACTCAGACCTCGTGCGCGCCCCAGCCGAGTTACGGAGGGGGGTCGTCCGGCGGCG
GCGGCAGCGGCGGAAGCGGCTGCTTCTCCAGCGGCGGGGGCGGCGGGAGCTCCGGCTGCG
GCGGCGGCTCCTCCGGGATTGGCAGCGGCTGCATCATCAGTGGCGGGGGCTCCGTCTGCG
GAGGTGGTTCCTCTGGAGGCGGCGGCGGCGGCTCCTCCGTGGGTGGCTCCGGGAGTGGCA
AGGGCGTCCCGATCTGCCACCAGACCCAGCAGAAGCAGGCGCCTACCTGGCCGTCCAAAT
AGATCCCCCAGGGTACCACGGAGGCGAAGGAGTTGGAGGTGTTTTCCAGGGGCACCGATG
GGCTTAGAGCTCTCATGATGCTACCCGAGGTTTGCAAATCCTTCATGTCTTAACCTACCT
GGAAGAAGCCATTGAGCTCTCCGGCTGCATCTAGTTCTGCTGTTTAGCCTCTTTGGTTTC
TGTACAACTACCTCCCAACCCCAGTGCCTCAGTCAATAAATTTGCAAATTCATGAG
aatttttaggtctccaagagtatttgtagtgttcaagttcatccattccattccattctt
ctcctttcctgcattcgctcattcacacttacattcattttacaaatgcacggactctat
tggcggaaaggtgagtggatagatgggagtcaccaggagagggaggaatggctggcaaac