Gene LAMB3 Variant 1
DNA : 37.51 KbNT_021877
mRNA : 3971 bp NM_000228
CDS : 3519 bp NP_000219
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  44 bp
cccacttgcccagtcccgtcctgggaggtgggggtgcagtgacgacagatgggtgtgacg
gctgccagattcctgagacccgccctgcggtggggctacacccagccagggagtctccag
aggtgaggctgttgtttaaaaacctggagccgggaggggagacccccacattcaagagga
GCTTTCAGGCGATCTGGAGAAAGAACGGCAGAACACACAGCAAG
gtatgttacctgtctttacctgcctggtgcgggccggatgcgggaggaggactgtatctc
tggatgcctggggcctggtttcagggcctgatttattcctcttcctgggagctcactcag
gtgagctaggttaaaatgtctgctacagttttgatttctttttcacatttgataagcacc
EXON 2  65 bp
agggtctagagctccagcattttccaagctacaaatgtatctgctgctccaagtgtccta
gatcaggaccctaggtaaagacttctgaaaaatacttgagtctagaaacagaaaagaaaa
agggctagtgtgctctaggggtttgcactgttgtacccagtttgctttgctgtgtcctag
GAAAGGTCCTTTCTGGGGATCACCCCATTGGCTGAAGATGAGACCATTCTTCCTCTTGTG
TTTTG
gtaagtaccccttcccatccttccaggccctgttatatggcagggaggcaacagccacag
ggagaaggagagtttaccaaagtgtgggcatcacctgtcacctgtagtcccttcagttgg
gaatacttgtctactggggacacctgtgagatttccccattcctttgggcctttggggaa
EXON 3  155 bp
aatcaactttcaaaatataacagtatcaatactgcaattattactgccagcagcgagtgg
aagcttgagtgagggaaaggatataatcttgctaatgtcagcttccctgaaagatactgg
ggtggccagtgaggtccctttttttctggactgctccatcacacatccctgtgatttcag
CCCTGCCTGGCCTCCTGCATGCCCAACAAGCCTGCTCCCGTGGGGCCTGCTATCCACCTG
TTGGGGACCTGCTTGTTGGGAGGACCCGGTTTCTCCGAGCTTCATCTACCTGTGGACTGA
CCAAGCCTGAGACCTACTGCACCCAGTATGGCGAG
gtaggccctacttcccaggactggaggaaggcgggatgggaggggtgtgtgagctgccat
ttgtccactgaatacttagaatgtacttggtgtaggccaagccctgtgtactacacggac
tggggagtgcagtaaaagtataaggccagatccttgcctctaaggaatttacctgttggt
EXON 4  115 bp
ccaattaaaaggtgatcaatagctgtgttttaagagattaacccttcaaattgtattaat
aaaattagtgattcctaagggcaggatttccacagaggagatatgctgggatctcaggac
gcaagggggaattctatcaggaccccacctctgagtgtctgctatctccctctcccacag
TGGCAGATGAAATGCTGCAAGTGTGACTCCAGGCAGCCTCACAACTACTACAGTCACCGA
GTAGAGAATGTGGCTTCATCCTCCGGCCCCATGCGCTGGTGGCAGTCACAGAATG
gtgagcatttgccatctacgggaactcaaactgtacagcctccacaggataagacggatg
gaaggtgccctataaccctttgggtttcccaggcatttcttatggtggtgtgacatgggt
gattgataagaagaatctttctgcctcatatttggggtctgttggatgttatggtagaag
EXON 5  74 bp
gatcttgaatagataatataagcagaaacataccactccccactcctctccaagagggag
tttggaaaatcaaggttagagagtttctgagttcctagagctagtctaatccagggcttc
cttcagggctggggaagtggacagtctctggatgacagtttctattttttgtccttccag
ATGTGAACCCTGTCTCTCTGCAGCTGGACCTGGACAGGAGATTCCAGCTTCAAGAAGTCA
TGATGGAGTTCCAG
gtgtgcctcctgggggtggcagtggataggagaggggctcctgggccatgtgggcgtgga
gccatggaggagcacagtgtccttgtctctctgggttggggcaacactcaccatgagcct
atatcatggtgacagaagaggactcgctcctgggctaaaagtggcacctcctggctccct
EXON 6  192 bp
gggagaaacttctgtggcctgtggtatgccaggaggtttggacccggatgctccgagccc
acttgctcccactgggccccctttctcccgagttcactggaggagcctgtctctctgctt
gtgtctccacggggcacagccccagtgcctcccctctgcacactgcccctgtctccacag
GGGCCCATGCCCGCCGGCATGCTGATTGAGCGCTCCTCAGACTTCGGTAAGACCTGGCGA
GTGTACCAGTACCTGGCTGCCGACTGCACCTCCACCTTCCCTCGGGTCCGCCAGGGTCGG
CCTCAGAGCTGGCAGGATGTTCGGTGCCAGTCCCTGCCTCAGAGGCCTAATGCACGCCTA
AATGGGGGGAAG
gtaggtagagggaatcctgaaaagtaggcctggggagaaatccctgatgtcccactgttc
acacagccacacggactcctgagaagggacggaaacaccctcgccagctccccttgctga
ctttcctgaattcccaccagtaatgacccctgtggccaccctcaaaacatttgctgctta
EXON 7  64 bp
gcccagtgatcatctttctcccccacagcagatgacaagcctcatagccatggtctatct
caggttccaggtaacaaggacttcaagtgtgaggcatataatggaaagaaaggtttcttc
tgaactcggggcacactatttgtctcttcttcagcgcttctctttcccttccctctgtag
GTCCAACTTAACCTTATGGATTTAGTGTCTGGGATTCCAGCAACTCAAAGTCAAAAAATT
CAAG
gtcagtgtggttacttctcttgtccatggaactatgggtgggaaaggaaacagagttgga
gcccaggtcatggaaatttcctggtctttcatgtttttgtcaacgtggttggggatttga
tacttgccctgcttgccccatagggatattgtctgtgggatgctatgggatggttgaggt
EXON 8  194 bp
gatttgatacttgccctgcttgccccatagggatattgtctgtgggatgctatgggatgg
ttgaggtctggagaggatggcccacggtatcacatatgaaggagactctatgtgcctcta
acttcctttctttattttccattctccaactcttccctccttgctgtttggccctctcag
AGGTGGGGGAGATCACAAACTTGAGAGTCAATTTCACCAGGCTGGCCCCTGTGCCCCAAA
GGGGCTACCACCCTCCCAGCGCCTACTATGCTGTGTCCCAGCTCCGTCTGCAGGGGAGCT
GCTTCTGTCACGGCCATGCTGATCGCTGCGCACCCAAGCCTGGGGCCTCTGCAGGCCCCT
CCACCGCTGTGCAG
gtaacagcctagggtgggaaggggagaggaagggggcaggaccagggcagactacagaca
ttcttggggctcctgtaaagcaggaagggcactaaatctaagacttgggtatttaatact
tcagcagcaacaacaaaaaatcgaagtggttttcgttccaaaaatcagaatcatttagta
EXON 9  121 bp
tagcagacagtttcacaggagctgggtgaagtctgcggcattcagaggaagcttcctgga
agggttgggatctaagccagatcctgagtggtgcgcagagggtcagagggcagtgggcag
gtccatccctggtgcccttctttgttgattactcctgatggctgacggtccccctcccag
GTCCACGATGTCTGTGTCTGCCAGCACAACACTGCCGGCCCAAATTGTGAGCGCTGTGCA
CCCTTCTACAACAACCGGCCCTGGAGACCGGCGGAGGGCCAGGACGCCCATGAATGCCAA
A
gtaggagctttggatcacccctcccctgtagggtctgggtcgagtgctggcccctctagg
ccttgatgatctcacctgggatgcagggggatccagtctttcttatgtaaatctaaactg
aattgcaccattacaattcaagctctcctggctctgtgaggatggagagagtatttgggt
EXON 10  189 bp
tcttattggtcatgtaaccttaaataagttatacaaacctcccttgccctcagtttcccc
acttccctgccttgatcatcttgcagagttgttacagatgccagtgagcttttgtggagc
atgctctgtagatagcaaaggtgtgggtcagatgtcagccctgggactctctttttccag
GGTGCGACTGCAATGGGCACTCAGAGACATGTCACTTTGACCCCGCTGTGTTTGCCGCCA
GCCAGGGGGCATATGGAGGTGTGTGTGACAATTGCCGGGACCACACCGAAGGCAAGAACT
GTGAGCGGTGTCAGCTGCACTATTTCCGGAACCGGCGCCCGGGAGCTTCCATTCAGGAGA
CCTGCATCT
gtgagtagaggctccggagtcccagagtgtcatttgtctgttactccccatctcctctgg
gtacaatagagtacatgttcctgggcacaccaaggccctcagggagcatgaaaacttggc
tgtgagtcaggatttgtgggagattattttaatttagctattactgagcaagtcacttaa
EXON 11  156 bp
ttatttttattttatagacaaggaaattgaggcacagagggattaagtaacttgactaag
gctgtgaatttgaaatccagtggtggaacaaggatttgaaccaggcagcctggctcctgg
aatctgctctgaactctacttttctttgttcctactgcggtggctgctgttgtctctcag
CCTGCGAGTGTGATCCGGATGGGGCAGTGCCAGGGGCTCCCTGTGACCCAGTGACCGGGC
AGTGTGTGTGCAAGGAGCATGTGCAGGGAGAGCGCTGTGACCTATGCAAGCCGGGCTTCA
CTGGACTCACCTACGCCAACCCGCAGGGCTGCCACC
gtgagtagggggcttggcccagcatgacgtggggtgggctgcatggggccaccagaccca
cggcttgccctgctcactgtgctctcttcagaggaaatcccactgcagggtagacagagg
gggtatgcccgggcctttgccaggagtccggacttcttgccctcttacccagcgccagat
EXON 12  197 bp
gctgccaggtggctggaactggtgggacagcgcaggggtcctgtgagtcagccatgtcat
ctgcagggaagggccctgcccagttcttttcccaggcagcgcccctccctggatgtgtgt
cctctgggggtgagtttttcatggagcgtctgcctgagctcagcagctctcctcctgcag
GCTGTGACTGCAACATCCTGGGGTCCCGGAGGGACATGCCGTGTGACGAGGAGAGTGGGC
GCTGCCTTTGTCTGCCCAACGTGGTGGGTCCCAAATGTGACCAGTGTGCTCCCTACCACT
GGAAGCTGGCCAGTGGCCAGGGCTGTGAACCGTGTGCCTGCGACCCGCACAACTCCCTCA
GCCCACAGTGCAACCAG
gtacgaagtgagggtggtccgggggccccctcagtgggaggggggtcctgagcaccagcc
tctctgctgcccctccatgctgcccttctaggcctctcccctgtcagactgggcgtcttc
tgtccccgttctcatttggggaagtcaccagatgtccctccctctgtggctcttggccgt
EXON 13  112 bp
gccttgacttcaaggctcatctctgagtgggagcccttgttttgtgggcacagcagctct
ggaggtggccatgagccctggattctacctgtggaccaggaatctaggacacagtccctg
acaccagggtaaggcagaggctgtgaggcagggtccactgacggtgctctccccacgcag
TTCACAGGGCAGTGCCCCTGTCGGGAAGGCTTTGGTGGCCTGATGTGCAGCGCTGCAGCC
ATCCGCCAGTGTCCAGACCGGACCTATGGAGACGTGGCCACAGGATGCCGAG
gtgcatgctcaaagcctgggggacgctgaggctctgggggccgagcacgcgggtgggcac
atggtgggggcgtgtaggtctgcagcagggcaggatgtcctgtactgatgcatgtggtgt
gggcctgggcagccctgtgagtgcacacactccggcctgttggcatggcctccaagcccc
EXON 14  379 bp
gctaagtaagcgtttgctttcactgcagctgttaccatggcttttattctggctgcgact
tctgttattctaagtcatgtagaaagagcctcaggtcagacctcctcttcagggctctcc
ctgacagctgcttctgtctccctgacccctgtctctgactgtcatttttcttggccctag
CCTGTGACTGTGATTTCCGGGGAACAGAGGGCCCGGGCTGCGACAAGGCATCAGGCCGCT
GCCTCTGCCGCCCTGGCTTGACCGGGCCCCGCTGTGACCAGTGCCAGCGAGGCTACTGTA
ATCGCTACCCGGTGTGCGTGGCCTGCCACCCTTGCTTCCAGACCTATGATGCGGACCTCC
GGGAGCAGGCCCTGCGCTTTGGTAGACTCCGCAATGCCACCGCCAGCCTGTGGTCAGGGC
CTGGGCTGGAGGACCGTGGCCTGGCCTCCCGGATCCTAGATGCAAAGAGTAAGATTGAGC
AGATCCGAGCAGTTCTCAGCAGCCCCGCAGTCACAGAGCAGGAGGTGGCTCAGGTGGCCA
GTGCCATCCTCTCCCTCAG
gtaattccctttccctgccaagcatttgcaagaattatgctccaggggttccagtaccgg
gcatgctggtccttccttacatttgtacagtgcattacagtttaaaggcattttcacagt
gctctctctttcaaccattacaacagtcctgtgaggctggtgtggttttgcagatgagaa
EXON 15  161 bp
gtgctggtcgccaagcctctgtccagcggaacccccttagcctgtggattctctgttctg
ttgcctttgcccaaggtctctgtttgttctgactcagtagcagttgctctgaggggatag
ctgctttggggaggcaaaactccctcctatattttagtgtaagctcctctcccttctcag
GCGAACTCTCCAGGGCCTGCAGCTGGATCTGCCCCTGGAGGAGGAGACGTTGTCCCTTCC
GAGAGACCTGGAGAGTCTTGACAGAAGCTTCAATGGTCTCCTTACTATGTATCAGAGGAA
GAGGGAGCAGTTTGAAAAAATAAGCAGTGCTGATCCTTCAG
gtgaggagaggggcacccggataaccccgggcatgggcactgccgtggtgggcatgccac
cccctctccctcctgctcctcctccatctccattcctcatgcttctcgccacaggagcct
tccggatgctgagcacagcctacgagcagtcagcccaggctgctcagcaggtctccgaca
EXON 16  221 bp
gtctccttactatgtatcagaggaagagggagcagtttgaaaaaataagcagtgctgatc
cttcaggtgaggagaggggcacccggataaccccgggcatgggcactgccgtggtgggca
tgccaccccctctccctcctgctcctcctccatctccattcctcatgcttctcgccacag
GAGCCTTCCGGATGCTGAGCACAGCCTACGAGCAGTCAGCCCAGGCTGCTCAGCAGGTCT
CCGACAGCTCGCGCCTTTTGGACCAGCTCAGGGACAGCCGGAGAGAGGCAGAGAGGCTGG
TGCGGCAGGCGGGAGGAGGAGGAGGCACCGGCAGCCCCAAGCTTGTGGCCCTGAGGCTGG
AGATGTCTTCGTTGCCTGACCTGACACCCACCTTCAACAAG
gtgacttggggcatggagtcccacttcctggagcccacaccccagcttgtcacacaccaa
ctgctgccacctgcttcctattagggcagatctgcccctgtgagaaccccactcccccag
ccatcccgacccttgtactgctcactgtgagctcagtggttgccaaggaaaccagtttct
EXON 17  198 bp
tgtgagctcagtggttgccaaggaaaccagtttctggtccttagctctcatggagatgtc
tggctgtttctggtgcttggttgtcatggagatgtctggctgttggtttcccaggtgtgg
ggtgggattggttattgaggggctttgggtagcctctttaacaccgccatctgtccacag
CTCTGTGGCAACTCCAGGCAGATGGCTTGCACCCCAATATCATGCCCTGGTGAGCTATGT
CCCCAAGACAATGGCACAGCCTGTGGCTCCCGCTGCAGGGGTGTCCTTCCCAGGGCCGGT
GGGGCCTTCTTGATGGCGGGGCAGGTGGCTGAGCAGCTGCGGGGCTTCAATGCCCAGCTC
CAGCGGACCAGGCAGATG
gtaagtgcagccgaggcggggtgggcacaggtaggaggaggcagacaggatagatccccc
gggcaagtcagagttcccattttacactaaagtccagagattttaggtgacctgcttaag
gtgccacagcaagtgcaagatagttttttttctcttttactgaacatccacatgtaagct
EXON 18  145 bp
tgccacagcaagtgcaagatagttttttttctcttttactgaacatccacatgtaagctg
ggttggttacaaatgcttcctaggtaggtcttggcatagaggatgatccgcagaatcgtg
gggctgctgagaggttcccttggggccttaccccttctgacctagagtgtatgtcaacag
ATTAGGGCAGCCGAGGAATCTGCCTCACAGATTCAATCCAGTGCCCAGCGCTTGGAGACC
CAGGTGAGCGCCAGCCGCTCCCAGATGGAGGAAGATGTCAGACGCACACGGCTCCTAATC
CAGCAGGTCCGGGACTTCCTAACAG
gtgagcccagtctccaccccaccttggctgctgttccagtcctgcctgtcccgcattccc
atgttcagtgcatcagccagccctccctccctagtcccaggcctgcaacatccaggcctc
cacttctccttggcaccatggccatgaccttctcgttctcccgtctgccctccccaccca
EXON 19  208 bp
cccagaaatccctggagaacaggcgcctgagtctggttgaaagggggcagcagctccttg
ggacaccacggtagaggggccactgtgggtgccttccacaagtgctgctcagctaggaga
ggcctcgtatctctggggaggttagtgggctcctacagtcaaatgcgtgttgtcttccag
ACCCCGACACTGATGCAGCCACTATCCAGGAGGTCAGCGAGGCCGTGCTGGCCCTGTGGC
TGCCCACAGACTCAGCTACTGTTCTGCAGAAGATGAATGAGATCCAGGCCATTGCAGCCA
GGCTCCCCAACGTGGACTTGGTGCTGTCCCAGACCAAGCAGGACATTGCGCGTGCCCGCC
GGTTGCAGGCTGAGGCTGAGGAAGCCAG
gtatggccttgggccctgaacttctctctgcccaggattaagctggcgttttgctcctca
accccgttgctgggagaggggtacagagggctgggagacaggagggggtgcttaccatgg
tggagagtggtacacagagtccagagtgcaggttaaacttaatttgcatgactgtgtctt
EXON 20  142 bp
acattcatcacgtctgcttggtggggtcctgggacatcaaagctactgagttaatacttt
ccttgctctttgccttggctgggaagggtgttcttttggactggtgtgtgagtcgaacca
cacattgattcactgttcactcattctctctctcctctccctgctgcttctctcacccag
GAGCCGAGCCCATGCAGTGGAGGGCCAGGTGGAAGATGTGGTTGGGAACCTGCGGCAGGG
GACAGTGGCACTGCAGGAAGCTCAGGACACCATGCAAGGCACCAGCCGCTCCCTTCGGCT
TATCCAGGACAGGGTTGCTGAG
gtgaggcattatggcttcctccgcccatatttgggcataaacaggaaaatttgggcacca
ggcatagaaaatgccagaaagtgactagataaaacctgaggtggagttctagaggagagt
gacaagctttgggcaggctatgggccttggattttctggtcttgtggctgggatgcagaa
EXON 21  177 bp
tgggccttggattttctggtcttgtggctgggatgcagaaggaggggtgagaggtgggca
attgtgtttgttctggttggagagggtttttgctgcctgatgagttggagaaaaaatggg
gatgaaccccccgacctatgagacccaccacaaaggccagatctccctctttccacaaag
GTTCAGCAGGTACTGCGGCCAGCAGAAAAGCTGGTGACAAGCATGACCAAGCAGCTGGGT
GACTTCTGGACACGGATGGAGGAGCTCCGCCACCAAGCCCGGCAGCAGGGGGCAGAGGCA
GTCCAGGCCCAGCAGCTTGCGGAAGGTGCCAGCGAGCAGGCATTGAGTGCCCAAGAG
gtacagagaaggcggagttagctcaatgatgtacggccagtgagggggtcctgagcagag
gaggactttgcacactttataagaccacaaactcaaaagtgcttagaataacagaaccag
aagaggcttgagagtcaacccaaacctggccaggcatctgatttctccctccactgcttt
EXON 22  154 bp
agaagtttaagtcatagtctgtggctcaggggtttcaataggcaaaaccaatgctattgg
gggctaataggaggcaccttcccactgtgtattgatttgggtgatatcaagtgctttggc
cacaggtctttaggaccttgcatgatgacaatgacactgagactattctacctttttcag
GGATTTGAGAGAATAAAACAAAAGTATGCTGAGTTGAAGGACCGGTTGGGTCAGAGTTCC
ATGCTGGGTGAGCAGGGTGCCCGGATCCAGAGTGTGAAGACAGAGGCAGAGGAGCTGTTT
GGGGAGACCATGGAGATGATGGACAGGATGAAAG
gtgagggaatggtttaggggcatggactattgggcattcatgaaggctggtcccacccaa
cccaaggcttctgaagcccgttcttattggagctagccgtgctatgggagtgagatcaaa
tgagattttttctgggcatctagcatgtatgaggctggggaatgcagagatggtcccatg
EXON 23  508 bp
tgggatggggctggagaggcatgaagctggaggggcaccactgctttagaggccagattt
ttctggaggggattcctctacacatgctacctccagttagcaggaggggaaggaagggtt
gggagtcttggggagtctcaccatcaactcctcctcctgctgctgttccatttgcctcag
ACATGGAGTTGGAGCTGCTGCGGGGCAGCCAGGCCATCATGCTGCGCTCAGCGGACCTGA
CAGGACTGGAGAAGCGTGTGGAGCAGATCCGTGACCACATCAATGGGCGCGTGCTCTACT
ATGCCACCTGCAAGTGATGCTACAGCTTCCAGCCCGTTGCCCCACTCATCTGCCGCCTTT
GCTTTTGGTTGGGGGCAGATTGGGTTGGAATGCTTTCCATCTCCAGGAGACTTTCATGCA
GCCTAAAGTACAGCCTGGACCACCCCTGGTGTGTAGCTAGTAAGATTACCCTGAGCTGCA
GCTGAGCCTGAGCCAATGGGACAGTTACACTTGACAGACAAAGATGGTGGAGATTGGCAT
GCCATTGAAACTAAGAGCTCTCAAGTCAAGGAAGCTGGGCTGGGCAGTATCCCCCGCCTT
TAGTTCTCCACTGGGGAGGAATCCTGGACCAAGCACAAAAACTTAACAAAAGTGATGTAA
AAATGAAAAGCCAAATAAAAATCTTTGG
aaaagagcctggaggttcaacgaggaaaaacagtctgtcccctcactgggtaaactcttg
ccactgtttctgtctcccatttggggtttgtggggactcctctattcaagcccatatttt
gctctcctctgttccacccggctttctgggcacccagatttagggagtctgggcccctct