Gene KHDRBS1 Variant 1
DNA : 29.98 KbNT_004511
mRNA : 2685 bp NM_006559
CDS : 1332 bp NP_006550
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  488 bp
ggagcggagggaaagccagagtcgggaggcgacttctcggacgccgcggcggtgcgcagg
cgccgtggccggactggggactttgttctccgcggagaaacccaagggcggtgccggtgg
ctggctgcgcacgcgcgccgcctcatttccggtgctctctctcgctgggtcgctcgggtc
GGCTTCGGTCGCTACCGCTCCCGCTCTGCCACCCCCGCCAACCGCCGCTCGGGCCTCCGT
CGCTGCCGCGTCGCTTTCTCGCTCCTTGGATCGCACATCCTCCCAGATGCAGCGCCGGGA
CGACCCCGCCGCGCGCATGAGCCGGTCTTCGGGCCGTAGCGGCTCCATGGACCCCTCCGG
TGCCCACCCCTCGGTGCGTCAGACGCCGTCTCGGCAGCCGCCGCTGCCTCACCGGTCCCG
GGGAGGCGGAGGGGGATCCCGCGGGGGCGCCCGGGCCTCGCCCGCCACGCAGCCGCCACC
GCTGCTGCCGCCCTCGGCCACGGGTCCCGACGCGACAGTGGGCGGGCCAGCGCCGACCCC
GCTGCTGCCCCCCTCGGCCACAGCCTCGGTCAAGATGGAGCCAGAGAACAAGTACCTGCC
CGAACTCATGGCCGAGAAGGACTCGCTCGACCCGTCCTTCACTCACGCCATGCAGCTGCT
GACGGCAG
gtaagggggcctcccgtgtccctctgggtcgcccggccatcccgggcatgagtggccctg
gctttgttcctctcgcttcccgccccctcgggaccgaggcagtcgggagttccggtctca
tcctcatttttgggagcctggattccacattcccacctcagcccggagtgcgtgggagaa
EXON 2  125 bp
tttgggctttctagtcaacttcatatagctttagtgctttcagctagtttctttctgaaa
ttggcacatttgtgtgaactatttggtttcactatatggtattccatgttattgctttaa
gcagacttcaaaatttgcatttatttaccagggcaaaaataaattgtttttcctattcag
AAATTGAGAAGATTCAGAAAGGAGACTCAAAAAAGGATGATGAGGAGAATTACTTGGATT
TATTTTCTCATAAGAACATGAAACTGAAAGAGCGAGTGCTGATACCTGTCAAGCAGTATC
CCAAG
gtaaggcaaaaagtgctttggatctttgagttatctttatagttatgagagagtcatggg
ctataataaagactcctggggattgtgatgctttagaaacttaagcctgtgaagcttctc
tttcatgcttgtagtacctgttactgagagttgaaatatctaagttcttaactaataaca
EXON 3  117 bp
ctttctagtttcataaccttaagctaatcactttattaatatggcttcagtgtccttcag
taaaatgggaatggtaatactctacctttgcagggttgtttaaaatcaagtgaggtaatt
tatgtggaaatgtttttatatagtagcatgtatatttagaaatcctctattttctgtcag
TTCAATTTTGTGGGGAAGATTCTTGGACCACAAGGGAATACAATCAAAAGACTGCAGGAA
GAGACTGGTGCAAAGATCTCTGTATTGGGAAAGGGCTCAATGAGAGACAAAGCCAAG
gtaagctcacattagtgaggcaagaggacatcctaatgccttctacttgcccagaatgca
gtatggatgtcttatagaggcggcaagaattttgtatgtgtacagaatgtggctccttta
agtttgcactggatgcaagagattatacaccaagttaatttacttggcttggcaaccctg
EXON 4  147 bp
ctttactgtttttcttttttcttttttctttttttgtttaattcttctcagctcatacca
attaactttactgtttttcatggacattaggggtatttcttgctgttcctttggcttaga
ggtaaaggtggtgttttctccctagtccatggtgtgacatttctctgcatttttccatag
GAGGAAGAGCTGCGCAAAGGTGGAGACCCCAAATATGCCCACTTGAATATGGATCTGCAT
GTCTTCATTGAAGTCTTTGGACCCCCATGTGAGGCTTATGCTCTTATGGCCCATGCCATG
GAGGAAGTCAAGAAATTTCTAGTACCG
gtaaggaaatccatatcctgtgtcttctgagcaaaagagaactgggatcttatactgttg
tgaaggtaggggttcttaactaaggtctctgcataacctgtatgtataccaaattctgca
cttatgttcattttccttaggtagttcgttacttgcacctagttctcaaagcattatgct
EXON 5  134 bp
caagacttttctcaaagaggtgacagatagggtgccatttgacttcagagaaggaatgac
ctgagacctcatctgggctctcaagagctcttcttagaattcaagtctcccgtggaccag
atgatttctcagtagaaagtgtagataccacacaatactccttgtatctttcgttcccag
GATATGATGGATGATATCTGTCAGGAGCAATTTCTAGAGCTGTCCTACTTGAATGGAGTA
CCTGAACCCTCTCGTGGACGTGGGGTGCCAGTGAGAGGCCGGGGAGCTGCACCTCCTCCA
CCACCTGTTCCCAG
gtaaaaataatggagacacccagaaataggatgtgaatttgactactagtgtcatctctt
ttagtggtgctcttatgtctagcttaggaagggtctcaggatttgtatgttgcataaaga
acagaattctacaaccatactctcacacctgtaatcccagcactttaggaggctaaggca
EXON 6  202 bp
tataggacctgggggatcttgcagtgtgggtcctttaccctgtacattcctctgtgcttt
aataatagcctagttaaggcttcataaaatctgcctaattccagaatttgtaaacaaatc
agaacataaaagtggcctgtttataaaaagctccatttaagataaactttcattttgtag
GGGCCGTGGTGTTGGACCACCTCGGGGGGCTTTGGTACGTGGTACACCAGTAAGGGGAGC
CATCACCAGAGGTGCCACTGTGACTCGAGGCGTGCCACCCCCACCTACTGTGAGGGGTGC
TCCAGCACCAAGAGCACGGACAGCGGGCATCCAGAGGATACCTTTGCCTCCACCTCCTGC
ACCAGAAACATATGAAGAATAT
gtaagaaatttgaacaatgtgccatttcccagtacctagaaggctgctaaaggaagttga
atgacagggcctcggtcctttatgtaggtgtcatggactgcctgtaagatttgcaatctg
ccctcttctcttgcagtgaatgttgaactattagaagatttttccattttaggcagggtt
EXON 7  68 bp
gttttctttgtttagtaaccctttctcttttgactattctacagtaggcattaacatttt
ggagggaaatgtcatgtccttttaattcagaagcctacttactcccatgggatgtaatta
cctttcctactctctatgattttgatcttttatttcatttttttgttgttgttgttctag
GGATATGATGATACATACGCAGAACAAAGTTACGAAGGCTACGAAGGCTATTACAGCCAG
AGTCAAGG
gtgagtcaggcagtataagcactgttttttgtcctgaggatggatggagggagttggagg
aacagagagatttagacagtacaaccctaaggagcagaatggttcgccttttgagggtat
ctcctctgcaacccccacagtcctgactggtcttgaactcttgagctcaagcagtcctcc
EXON 8  59 bp
attttataagtacatagtctatacatattttggaaatactttacggtttagggatggggc
agaatgagtattttcctgtattaatacacttagtaaaatgactgacttatggaagtattt
gagagaaagttgaaacatagttactctgtagcttcctaacactctgcctttggctttcag
GGACTCAGAATATTATGACTATGGACATGGGGAGGTTCAAGATTCTTATGAAGCTTATG
gtatgtctttatctctgtggtggggcagaatgtacaagtaagtgcctgggagaatgctgg
tgactaaagtattgagagtcagacaaacacacctacggataaacctttagaaggccaaga
ttttgctagatgtgacagtaagagttctgctcttgcttaaattttgcggtacatggtaga
EXON 9  1345 bp
aaaattgcccaggctgcccaagagggccaagccaagtagagagcaaggaacaccagggga
agtgtcaagacattagaagaaactcagtgtttttggtgatctttactatgtgacctatcc
ctgcttatccctaagtgctgtcgccacatggtttataaactgtctttgttttccccacag
GCCAGGACGACTGGAATGGGACCAGGCCGTCGCTGAAGGCCCCTCCTGCTAGGCCAGTGA
AGGGAGCATACAGAGAGCACCCATATGGACGTTATTAAAAACAAACATGAGGGGAAAATA
TCAGTTATGAGCAAAGTTGTTACTGATTTCTTGTATCTCCCAGGATTCCTGTTGCTTTAC
CCACAACAGACAAGTAATTGTCTAAGTGTTTTTCTTCGTGGTCCCCTTCTTCTCCCCACC
TTATTCCATTCTTAACTCTGCATTCTGGCTTCTGTATGTAGTATTTTAAAATGAGTTAAA
ATAGATTTAGGAATATTGAATTAATTTTTTAAGTGTGTAGATGCTTTTTTCTTTGTTGTT
TAAATATAAACAGAAGTGTACCTTTTATAATAAAAAAAAGAAGTTGAGTAAAAAAAAAAA
ACACACAAACCTGTTAGTTTCAAAAATGACATTGCTTGCTTAAAGGTTCTGAAGTAAAGG
CTTGTTAAGTTTCTCTTAGTTTTGATTTGAGGCATCCCGTAAAGTTGTAGTTGCAGAATC
CCAAACTAGGCTACATTTCAAAATTCAGGGCTGTTTAAGATTTAAAATCACAAACATTAA
CGGCAGTAGGCACCACCATGTAAAAGTGAGCTCAGACGTCTCTAAAAAATGTTTCCTTTA
TAAAAGCACATGGCGGTTGAATCTTAAGGTTAAATTTTAATATGAAAGATCCTCATGAAT
TAAATAGTTGATGCAATTTTTAACGTTAATTGATATAAAAAAAAAAACAACAAAATTAGG
CTTGTAAAACTGACTTTTTCATTACGTGGGTTTTGAAATCTAGCCCCAGACATACTGTGT
TGAGAGATACTTAGAGGGAGGGAGTAGGTTTTGAAGAGGTTGATGGTGGTGGGGAGGGAA
GGCCTCCTGAATTGAGTTTGATGCAGAGCTTTTTAGCCATGAAGAATCTTTCAGTCATAG
TACTAATAATTAAATTTTCAGTATTTAAAAAGACAAAGTATTTTGTCCATTTGAGATTCT
GCACTCCATGAAAAGTTCACTTGGACGCTGGGGCCAAAAGCTGTTGATTTTCTTAAGTTG
ACGGTTGTCAATATATCGAACTGTTCCCAAGTTAGTCAAGTATGTCTCAACACTAGCATG
ATATAAAAAGGGACACTGCAGCTGAATGAAAAAGGAATCAAAATCCACTTTGTACATAAG
TTAAAGTCCTAATTGGATTTGTACCGTCCTCCCATTTTGTTCTCGGAAGATTAAATGCTA
CATGTGTAAGTCTGCCTAAATAGGTAGCTTAAACTTATGTCAAAATGTCTGCAGCAGTTT
GTCAATAAAGTTTAGTCCTTTTTTA
atcaaagtaaatgtgatgaattgtcatttttttgggtggaccataaaatagttttctctt
tcaaataaacttaaattaactctaaagttaatgggcttgttaaaagttggaaacattctt
aaaagtggtgggggggattttattttaagtttaccaaaaaaaagttgatggagttgttaa