Gene KCTD3 Variant 1
DNA : 54.19 KbNT_021877
mRNA : 3705 bp NM_016121
CDS : 2448 bp NP_057205
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  227 bp
gacccctcctcccaggcaggctgcggcggcgtcggtggcagcggagcacggagaagaggc
ccgggcggcccggcggcctggaggccgcgaaaggtggaggccgggccgcccttgtgcacc
gcaggattgacccgggaaggggcagaagctagcgagccccgcccggccgccgggaaggtg
GGGGAAGCCCCGTGCACCCCCCGCCCTCCGGCCGCCGCCGCCCCGCTGGCCCTGCAGCCG
TCGCCGCTGCCTCGGGCTACAGCCCCGGGCTCGGCGGTCCCGGCTGGGGAAGGAGGGCGG
CGAGCGCGTCCGGAGCCGCCGGAGATGGCGGGAGGGCACTGCGGCAGCTTCCCCGCGGCG
GCGGCCGGCAGCGGCGAGATCGTCCAACTGAACGTAGGGGGGACCAG
gtgagtcggcgggtagcgggcttgcagcggggatgccttggcggcctcctcctttggtgt
cgacggggaccgagagtcgcaggaacgagggcgagcgtgggaggccaagcctggagggga
acgtgggggcctccaggcggcaagaacgtcgggcggattttggagctggtgaagcatctg
EXON 2  54 bp
atcttaactctgaattgaaagtagcaacgtttaaaaatattaactgtaataaatatattg
gtacagctataactataaaacatcttgtaaatcattagccagtgtattaaaacaagttaa
ctaatactgaaatttcaaatcatgttctcacttataataccagatgatttttaattgcag
ATTTAGTACCTCAAGACAAACTCTTATGTGGATTCCAGATTCTTTTTTTTCCAG
gtatgtcttataattctttagtgtatattttaatacatttatttaccaaaatataataat
gtttgtcagttaaattttttttaataaaaaaggttaactcttaaaattatatatttttga
acttggaagatagataacttacttttagtggtctttaacatttggtaaagaattagcaca
EXON 3  46 bp
taataatgtttgtcagttaaattttttttaataaaaaaggttaactcttaaaattatata
tttttgaacttggaagatagataacttacttttagtggtctttaacatttggtaaagaat
tagcacatttgtttatactcagattttaaaaactaactttagattattaatgacttccag
TTTGCTGAGTGGGAGAATTTCAACACTTCGAGATGAAACTGGTGCT
gtgagtataataataattgatacatattcctaaattaatgcttatagtgcttggtcctaa
catatagttactctaagaatataggagaactgatattttaataatcactgaatgaaagtg
gcataattttatttcttgtcatatgtagttttttataatcagagaagatccctaagtagg
EXON 4  74 bp
caccatctcatgaaatgcacacagactacattccaattttagaaacattaaagtttaaga
gtggaaacaaggaaatgtagtatttaagtaattaagacttcattccctattagtgttaca
gatattaaagttaaaagattaatttgtaatttgaaaataaaactgttctcttttttacag
ATATTTATTGATAGAGATCCAGCAGCATTTGCACCCATTTTAAATTTTCTTCGGACAAAA
GAACTAGACTTAAG
gtaagaaatgcactctttttaaagtaaattcttactgataaatatgtgtttttaatatgt
tttatgaaataaaaggttttttttgtttgtttttttttttccttgagttgcagtcttgct
ctgttgcccaggctggagtgcaggagtgcagtggcatgatctctgctcactgcaacctcc
EXON 5  59 bp
gcagtttttatttacactttttaatgattaaggataatagaaataaagagtattaggagg
aaaataatttttaaagccttatgactatatacatgaagaacctagaattttttcctttca
tgtcagatgataatacaggtttccagtgttagagaatttacatcatttgtttctttgtag
GGGAGTGAGTATTAATGTTCTCAGGCATGAAGCAGAATTTTACGGGATCACTCCATTAG
gtatgtgctcttttaatatttggtgtttatgatttgactcatgtatgaaagttgccctaa
atgaaatgtgtttatatcaggtcctaatttttgatggacttgttcagtgcttagtttttg
tggattttcatagtaaaaagatgttgtcaactctgacttaattaaaattttccttttctt
EXON 6  81 bp
gatggacttgttcagtgcttagtttttgtggattttcatagtaaaaagatgttgtcaact
ctgacttaattaaaattttccttttctttccttatcctcttgaactagagaaaataaaaa
tggagtactgtttttctgtttgcatgtactcttgacaagtttgctttgaaatgtttttag
TAAGAAGGCTTCTCTTATGTGAAGAATTGGAGCGTTCCTCTTGTGGCAGTGTCCTTTTTC
ATGGTTACTTGCCCCCACCAG
gtattttcactttattaaatcttttaaaaaattccttgtatcattaagcaagtacaagca
tatgaataggaaaaactgctccttgattattgagttttttgtctataaatctattagaaa
tggtaagaacttttgatttttatagaaattaagtcacattatatattggagcaggggttt
EXON 7  138 bp
ttttttcattttcattttattttttaattgtaattaaattatttgtaataatttgctata
ttggaagatgtatttcggctttaatgaaattcacatttttgtttctttgtcacaatgtga
tatttttaatttttgaaaggtgaacttaggaatgtatttgttttcttcttctctttatag
GTATTCCTAGTCGTAAAATAAACAACACAGTCAGATCTGCTGATTCTAGGAATGGTCTAA
ATTCTACAGAAGGTGAAGCCCGGGGAAATGGTACACAGCCTGTTCTCTCTGGAACGGGAG
AAGAAACTGTTAGGCTAG
gtaagcaaagattacagaaatagaaaaagaaaaatacgtatgtttttagtgctgggtgat
attgagtaattacttttaaagatttttgcctcatctccttttttatccagatttatcatt
tatatcttggaaaggtctcatttaacacttaatttttatttaaaatgttgtgtaatcttc
EXON 8  91 bp
acctcatgatccgcccgcctcggcctcccaaagtgctgggattacaggtgtgagccactg
tgcccggctcttaacaaaactattaaccaaaacaggcagaaggctgaaactggcctggtg
gctgtaatttgccaacccccggtttagaatgtaaaatatttctttttccaaaatcaacag
GATTTCCTGTGGATCCACGAAAGGTGCTAATAGTAGCTGGCCATCACAACTGGATTGTAG
CTGCATATGCCCATTTTGCTGTGTGTTACAG
gtagtgtataattaataatgctttgcttttacaggtggcagtttgaaaattaattgtgat
tttatatttttagattgaaaagctatttttttttagtcatcaagttttttccctgcatat
tttacccatgtctgtatcatctgattaagatttagtgtacttttattttcacagctaatt
EXON 9  191 bp
ttgtggcttcataggcaatatagatcaacaaaattttatttgtaataggaaggtggatgg
gtaactgtttagttttttttttgttttttgttgttgttttttgtttttggtgcattgatg
tgtattccgtttgcttcattgctgctgagtctaccttatgtgcctgttcttccttaacag
AATCAAAGAATCTTCAGGATGGCAGCAAGTGTTTACGAGCCCATATTTGGATTGGACTAT
CGAACGAGTAGCTTTAAATGCAAAGGTGGTTGGAGGGCCACATGGAGACAAAGACAAAAT
GGTTGCTGTTGCCTCAGAGAGTAGCATCATCTTGTGGAGTGTTCAGGATGGGGGAAGTGG
AAGTGAAATTG
gtaggaagaatcttgtttatgttgcaatttgatgatattaatattttgaagtttataaaa
gagattgacactgaatatgaaaattaacctggactgtcagttagctagagctgtcacagt
atttaatgtgggaggaatgatctgataatgaaggaaaaatgatgttttagaaaagacatg
EXON 10  116 bp
agttctgtaagctgcttaagagcttgtgagtttcttatttctagtccccaacacgtatag
cacatagtttgtagtaatgagaatataaattagtcacctttaagatgtttttaatccagg
ttttgattaattctaaaaatggtgactgattaacctttttattttttattgtcatttaag
GAGTGTTCAGCCTGGGTGTTCCTGTAGATGCTCTCTTCTTTATTGGTAACCAGTTGGTGG
CCACGAGTCATACAGGGAAAGTGGGAGTGTGGAATGCTGTCACTCAGCACTGGCAG
gttagtttaaagcatattacagaagtgaaaatatttctgaaatgtatgctgattatgtat
tttttttttccttgtagaattcgtactgtttctggttttggttatacaaatattgaataa
atgtagtggtaaatttttttgctagatgcatatttgagcatattttcaagagtttaagtt
EXON 11  88 bp
tagcatgtttgtgtatatgtgtgtgcacgcgtgcacctaaagaaagtttatttcctaagc
cctactaaaattggatattggttgcctctttaccagaagaatcaaagttttgaggaaatt
gaccagaaaatagaaattataattactatctaacatctgataatactctcactacatcag
GTTCAAGATGTTGTTCCTATAACTAGTTATGACACTGCTGGATCATTCCTTCTGCTTGGA
TGTAACAATGGATCAATATATTACATAG
gtaagtgttcagtcacttaaaatgctcctgcttaatgtaattttttaaatgagaacaaga
aaacattacctttcagttttaaatagatatgctatttattttaatgctgtttaaaatttt
tatgttttagatatgcagaagttccccttgcgaatgaaagataatgatcttcttgtaact
EXON 12  117 bp
tggatcattccttctgcttggatgtaacaatggatcaatatattacataggtaagtgttc
agtcacttaaaatgctcctgcttaatgtaattttttaaatgagaacaagaaaacattacc
tttcagttttaaatagatatgctatttattttaatgctgtttaaaatttttatgttttag
ATATGCAGAAGTTCCCCTTGCGAATGAAAGATAATGATCTTCTTGTAACTGAACTGTATC
ATGATCCTTCAAATGATGCTATTACTGCTCTGAGTGTTTACCTCACACCCAAAACAA
gttagtacatggccaattatatacattcttgactttttatctttttattcattagtttat
tatgtgactaggtcaaattaaactggtttatttctttttgagaactgcagtgcctaagga
tttcatctctactaagtctaaaatttgtattcagttttatactgaagtcaaacatgacca
EXON 13  171 bp
aataatgattttaagatgaccggagaagtcttaagatttttttttttactgaactggatt
tggggctgatataaacagtgaatccagctctgcctattttatcatagggaagctttgcga
gggtagcttttttattatcgttccataatgtatcacctgtcaactcttgactttatatag
GTGTCAGTGGTAACTGGATCGAGATCGCCTATGGTACGAGCTCTGGAGCAGTACGAGTGA
TTGTACAACACCCAGAGACAGTTGGGTCAGGTCCTCAGCTTTTTCAGACTTTCACAGTTC
ACCGAAGTCCCGTAACAAAAATCATGCTATCAGAGAAGCATCTTGTATCAG
gtaaaatgatttcattatactggtaaggaacttggctctgtgtgttattttcattaaaag
aatgaaaacgcagtgtttatgtgagaaaaatatactaaaagaagtactagaaaagtttaa
tgactgaagaaattatgattgtcttttaaagatttctttgagctggtcgtggtggctcat
EXON 14  156 bp
aaggtaaaacatccagttttctcacttttgttaagtagtcacaaatcaagtatagtttta
agataaatatgtcatttgccacttatactctgatctgtgtaatatagatgatagtgaaaa
aagttaaaatgagtttttaaaagtaattttgtattcttttgtgttctctttctctgctag
TCTGTGCAGATAATAATCATGTCCGGACGTGGACAGTAACACGATTCAGAGGAATGATCT
CTACTCAGCCAGGTTCTACTCCTTTAGCGTCATTCAAGATACTATCCCTGGAGGAGACAG
AAAGTCATGGTAGCTATTCCTCTGGAAATGACATAG
gtgggttaggttattttagggcatttttaggtactatattaactgttcagaagaagcata
tcaactaataaaaccacaaaaatgagttttaaatacaaattttccattttaattttgaaa
ttctaaacagaattttagtgtgtttttctgattaaattctataaattcacaaaattattt
EXON 15  97 bp
tctaatgcaaattgaagtacttgtatacatttattgcatgtctgatgttgagctgaaatg
tgataccatattggtacgtataagaaattcttttcttatattaatattaatgttcctttt
gtaaaatgagaaaaaataaaattttaattaattttttgacatttttgttttctgatcaag
GACCTTTTGGAGAGCGAGACGATCAACAGGTGTTTATCCAGAAAGTTGTTCCCATCACCA
ACAAACTATTTGTAAGACTCTCATCGACTGGAAAAAG
gtaacactttattgtaaaaatatttgtattcagaagccaccttttgtcttacaaaacata
tggcataatttgacatattgaccaaagagtgctactagaaacaaattgttgggacagaag
tctgttatctcataatcataactcaaaattaagacagtagactttatgcttactttctgg
EXON 16  185 bp
agctgtatattttttctggtttcagattttaaagatttacacataaattttaaatgattt
tttaaaagtcttttctagtataacatgtttgctttctttctttctgtctttttagtttca
tagcttctttttaaataattgctcattcccatcagggctctttctgcttttcttttgcag
AATATGTGAGATCCAGGCTGTTGACTGTACTACAATATCCTCATTTACAGTGAGGGAATG
TGAGGGATCCAGTAGGATGGGCTCAAGACCAAGGCGCTACTTGTTCACAGGCCATACAAA
TGGCAGTATTCAAATGTGGGATCTGACCACTGCTATGGATATGGTTAACAAAAGTGAAGA
TAAGG
gtaggttctcatacagaaagatgtttgtcacaaggttaagcttttcacttaagtgatttt
aatgactatttgttctcctaagatgtaggtggtccaaccgaagaagagctactcaaatta
ctcgatcaatgtgatttgagcacatctcgctgtgctactcctaacatcagtccagcaact
EXON 17  139 bp
accaaggcgctacttgttcacaggccatacaaatggcagtattcaaatgtgggatctgac
cactgctatggatatggttaacaaaagtgaagataagggtaggttctcatacagaaagat
gtttgtcacaaggttaagcttttcacttaagtgattttaatgactatttgttctcctaag
ATGTAGGTGGTCCAACCGAAGAAGAGCTACTCAAATTACTCGATCAATGTGATTTGAGCA
CATCTCGCTGTGCTACTCCTAACATCAGTCCAGCAACTTCCGTAGTTCAGCATAGCCACT
TACGAGAATCAAATTCTAG
gtaggttaaagagttgggtattataaacaaaatttatttcttttggggaaattgactgaa
atattgtaatcacatagttgttctagaaagccatacttctcaaggtacattttaaattca
gacattatgttaactttttaacagttttaccaaatttcttgataggcatatctggttctt
EXON 18  1675 bp
aattttatataccatctatataataaagagtacttgataagtatatttttacaaagagaa
atatggatataatacactttatgtatttatatagtgtgttttattggttgtataattaat
atgttcctgagaaatcacagagtgaaatctgaactgtcatttttaaaaactgtatttcag
CCTTCAGCTTCAGCACCATGATACCACCCATGAAGCAGCTACTTACGGTTCCATGAGGCC
TTACAGAGAAAGTCCTTTATTAGCAAGGGCAAGAAGGACTGAGAGCTTTCACAGTTATAG
GGACTTCCAGACTATTAATTTGAACAGAAATGTAGAAAGAGCTGTCCCTGAAAATGGTAA
CTTGGGTCCAATACAAGCTGAAGTGAAAGGGGCAACAGGGGAATGTAATATATCTGAGAG
AAAGTCTCCTGGAGTAGAAATAAAAAGTTTGAGAGAATTGGATAGTGGATTGGAAGTGCA
TAAAATAGCTGAAGGTTTTTCAGAATCCAAGAAAAGGTCATCAGAAGATGAAAATGAAAA
TAAAATAGAGTTTAGGAAGAAAGGAGGATTTGAAGGGGGAGGATTCCTTGGAAGAAAGAA
AGTTCCCTATCTGGCGTCATCACCAAGTACTTCCGATGGAGGAACTGACTCACCTGGTAC
TGCGTCCCCATCTCCTACAAAGACTACTCCATCTCCTCGGCATAAAAAAAGTGATTCTTC
AGGTCAGGAGTACAGCTTGTGAAAACTCACCAAAATGAATAGTTGTTTCGTTACATTTAG
ATGAAAGTTAAACTTTACTGAATTTCAGTACATTAGTTTTTACACTAAAACTTTACAAGA
TAAAATTGGACTTCATTTAGTATCTTTTTAACAGAATTACTTGGAATAATGAGATACAAT
AATCATATCTCTTTTGACATTTTGGAAATTTTTTTAATTTTACAAGTACATTTAACAGAT
CATTTATAAAGCAGGAGTCCATTTTAACACTTACCGACTTTTTTTGGTTTGGAAACATAT
TACCACGTCTTAATAGGATGGTGCCCATATAGGTGAGCATCCCTTTAGATCATGGGAACC
AGCAGACTGCATTCCTAATCTTCATTATGCCTGAGACTTGTCTTACAATGTTACCTTTAA
GTGAATCACATAATTGTCTTTGGAACTTGGTCTCCCAACACTTATTGTGATTGCAAAGTG
TTTACCAGATATTTGATGAGGTGCTATGTTTGTGAAAAACATATCATGTAATTCAAAAAC
ACTATTGATATTGAATACCAGATACCACTATGTAGTAAGTCTTTTAGGATGATTTTAATT
TAGTCGTGCGTCATTTTCTGATTCTCATCATTGGGAGATCTTAAATCTTAGCAAGCATTA
GCAATATTAAATGCCAAAATTCCATTGAAACTTTCAAGTTGGAGCAATTGTCTGTGTTTG
AAAAGATGAAATAAAAATAATAATCAAGGGCAAAGCTTTGAGTGCCCAGAAGGGAAAGCT
GTACCAGTTGCTAACCTGTCTTGTTTCAGGAGCCACCATGTTTTTTTTTCAGTGTTAACA
ACAATCATGATAATTAAATTAAAACACTAGTTTGTTCACTTGTAGGACTGCAGTTCTGAA
TTTTGGGTTAAAGGTTTTGGCTGCTGTAAGAATGTGAATTTGAATGTATTTTGAATTGTA
AGAGCAAAAGAACGTTTTTGTACAATTTTTTTTCATTTAATTGGAATGATCTTCAGGTTT
CTACAAATAGGGTAATTGTAAATTTAAAGCATTAGCATTTATTGGTGAATAATGTATATA
TCCCCATTCCAAGAAATATAAGTGAGTGAAGTTGAAATAAAATCTTTAAAATTTA
ctatattgccagtggtttcacaacagttctcttgtatttatttatcaattaaatcaaata
aaaatgattatgtcaatgcgttttcagttatttaagtaacagttctgtttaaagtgtgct
atatatgtttgttcatttctttgcttcttcccataatttaaaaaaaatggggggagggag