Gene INSRR Variant 1
DNA : 18.00 KbNT_079484
mRNA : 4147 bp NM_014215
CDS : 3894 bp NP_055030
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  338 bp
ggagactctccctgcggagtcccacgcgccccgggacccccgctgccctccttgggagcg
gtccccagcctgctgctccgccctcagggttggctggcctctcggcctgccttttgctca
gaaccctgtgtcattttctccctctggaggcccgagactctccctgtcactgtctgcatc
TCTGTCCCCATCTCTCAATCTCATGCTGAGTCTCTCTGTCTCCAACTGCCTGTCACTGTC
TTTGTGTCTCTGTGACTCTCATTTCTTTTTTTCTGTCTCCTGCTGTCTCTGTGTGGGATT
CCTTGTCTCTCTGCCCCTGCCCTCCCTCTCCTATCTGAACCCTGGTCTCTGTGTCCCTTA
GGGCTTATCACACCGTTCTCCCCAGAGTCACCGGGAGGAGAGCCGGGACTGGACACAAGC
CAGGGCTGGGACAATGGCAGTGCCTAGTCTGTGGCCCTGGGGAGCATGCCTGCCTGTGAT
CTTCCTCTCCTTGGGATTTGGCCTGGATACAGTAGAGG
gtgagtccccagaactggctcccagacccctacctccctcccagccagctgggaggccaa
aaaactgagcttgcagccacagcacctccacttactctgcactggaacatgggggttggg
gttagcgctcaggagaactgcccagcaggaaaagcagttagttccccacataaaggtgtt
EXON 2  552 bp
cctgcaggctgcaggtgagccctccggggcccaggaaggaggccaccccacacccagagc
agagcccggctcctcactcattgtcctactgccagtgtggctcccctccaaagctgccag
ggctggatggggaatttggcctgggctgtactcaatgctgcgtgccgtgtatgcccacag
TGTGCCCCAGCCTGGATATTCGCTCAGAGGTGGCAGAGCTTCGTCAGCTGGAGAACTGCA
GCGTGGTGGAGGGCCACCTGCAGATCCTGCTCATGTTCACAGCCACCGGGGAGGACTTCC
GCGGCCTCAGCTTCCCTCGCCTCACCCAGGTCACCGACTACCTGCTGCTCTTCCGTGTCT
ACGGACTGGAGAGCCTGCGCGACCTCTTCCCCAACCTAGCAGTCATCCGCGGGACGCGCC
TCTTCCTGGGCTATGCACTGGTCATCTTTGAGATGCCACATCTGCGTGACGTGGCACTGC
CTGCACTTGGGGCCGTGCTGCGTGGGGCTGTGCGTGTGGAGAAGAACCAGGAGCTCTGCC
ACCTCTCCACCATTGACTGGGGACTGCTGCAGCCAGCACCTGGCGCCAACCACATCGTGG
GCAACAAGCTGGGCGAGGAGTGTGCTGACGTGTGCCCTGGTGTGCTGGGTGCTGCTGGTG
AGCCCTGTGCCAAGACCACCTTCAGCGGGCACACTGACTACAGATGCTGGACCTCCAGCC
ACTGCCAGAGAG
gtgggcactggcacagaacatgaatgtagggaagggagagagcagggtcacatggggctg
ggtggccacaggatggtgtgggtcagtactttcagctgccactgttttttaatcctcact
catcctatgaggcaggtaaggaaactaaggctcagaaaagttacgtaaccaatgtggcat
EXON 3  304 bp
tccttgtcctcaagaatcccatcggaggggaacagagtcggcaaccagtgtcatctgaat
gggagggacctgggtgcagattgagtgtcatcccaagagaaacagggtggggccagcatt
ggaaggacagccaggactgagggggcatggccaacgtctaacacaccactctccccacag
TGTGCCCCTGCCCCCATGGGATGGCTTGCACAGCGAGGGGCGAGTGCTGCCACACCGAAT
GCCTGGGGGGCTGCAGCCAGCCAGAAGACCCTCGTGCCTGTGTAGCTTGCCGCCACCTCT
ACTTCCAGGGTGCCTGCCTGTGGGCCTGCCCGCCAGGCACCTACCAGTATGAGTCCTGGC
GCTGTGTCACAGCTGAGCGCTGTGCCAGCCTGCACTCTGTGCCCGGCCGTGCCTCCACCT
TCGGCATACACCAGGGCAGTTGCCTGGCCCAGTGCCCTTCTGGCTTCACCCGTAATAGCA
GCAG
gtgagtgtagggagggtggggggcaccctgggagcagtgaggaggcctgaggaggcccaa
actggtccaaggctcaggacatctgcttgctcctgctagcatattctgccacaagtgcga
ggggctgtgccctaaagagtgcaaggtaggcaccaagaccatcgactccatccaggcggc
EXON 4  143 bp
cggccgtgcctccaccttcggcatacaccagggcagttgcctggcccagtgcccttctgg
cttcacccgtaatagcagcaggtgagtgtagggagggtggggggcaccctgggagcagtg
aggaggcctgaggaggcccaaactggtccaaggctcaggacatctgcttgctcctgctag
CATATTCTGCCACAAGTGCGAGGGGCTGTGCCCTAAAGAGTGCAAGGTAGGCACCAAGAC
CATCGACTCCATCCAGGCGGCACAGGATCTTGTGGGCTGCACGCATGTGGAGGGAAGCCT
CATCCTCAACCTTCGCCAGGGCT
gtcagtacctactttggggccacacccctcctcctggtcatacccttcctcccagacaca
acccttacaatgacccaactcagcacaattttccatcatcctgggtcccagtcctgaggg
cccaccttcccggggcccccattcagcccccttgccccacagacccatcaccttccttgc
EXON 5  145 bp
tcctggtcatacccttcctcccagacacaacccttacaatgacccaactcagcacaattt
tccatcatcctgggtcccagtcctgagggcccaccttcccggggcccccattcagccccc
ttgccccacagacccatcaccttccttgctcctactccagccctgtcttcccatccctag
ACAACCTGGAGCCACAGCTGCAGCACAGCCTGGGGCTGGTAGAAACCATTACTGGCTTCC
TCAAAATCAAGCACTCCTTTGCCCTCGTGTCCCTGGGCTTTTTCAAGAACCTCAAACTAA
TCCGGGGAGACGCCATGGTGGATGG
gtaagggttaggcctctgaccagctccttctattacactccttcctccaacactcccaga
acagtggtgaagagaatgggctctggaaccaattttgctactcactaggcgtgtgactct
aagtaggttaacttctctggtcttcagttttctcatctgtaaaatagggctaatataaca
EXON 6  215 bp
ctggtcagtggcacagagtgggtatgcacgaatgcccccggtgtgctggtgtgagccagc
cactgagtgcccctctccccgggcccagcaaaacccttccaggaggaacccataagccat
cccctttcccaccccctgcccccacctccccgcagagcaaggtcccctggcctcccccag
GAACTACACTCTCTACGTGCTGGACAACCAGAACCTACAACAGCTAGGGTCCTGGGTGGC
CGCGGGGCTCACCATTCCCGTGGGCAAGATCTACTTCGCCTTCAACCCGCGCCTCTGCTT
GGAACACATCTACCGACTGGAGGAGGTGACAGGCACGCGAGGTCGGCAGAACAAGGCTGA
GATCAACCCCCGCACCAACGGAGACCGCGCCGCCT
gtgagaccccaaccccagtgccggtggacacgcggccacacactagacacgcacacccgg
gggagggagaaagctcgagggggacactctgagaagttctcctcagaggtctcactggga
atgggatgccgcggggtcagggtgggcgctcaagcagctggcaggcgcggttgcgagcag
EXON 7  127 bp
tgccggtggacacgcggccacacactagacacgcacacccgggggagggagaaagctcga
gggggacactctgagaagttctcctcagaggtctcactgggaatgggatgccgcggggtc
agggtgggcgctcaagcagctggcaggcgcggttgcgagcaggcccctcgccccacccag
GCCAGACTCGCACCCTGCGCTTCGTGTCCAACGTGACGGAGGCAGACCGCATCCTGCTAC
GCTGGGAGCGCTATGAGCCACTGGAGGCCCGCGACCTGCTCAGCTTCATCGTGTACTACA
AGGAGTC
gtgagtgccgggggcggggccggagcgggggcgggaccggacgaggccaatttcttcggg
accacaggcaggtgagggcggagctcagcgaggctatgaagacccaggaagccaggaccc
gcaagttgtactccgtggtagggcccaggtctggctctcttccctcaccttcttcatgcc
EXON 8  239 bp
tatcacagtccctcccctcctccgcccccccttgccaaggtctaacaggtggctggagtc
atggctttgccctcatgcatactggaaggacaatgacagtcctggggtgattcagagcgg
gggtgccagaacttgagggtggggttgaatgacccctcagctctggggatgggtgttcag
CCCATTCCAGAACGCCACAGAGCACGTGGGTCCAGATGCTTGTGGAACCCAGAGCTGGAA
CCTGCTGGATGTGGAGCTGCCCCTAAGCCGCACCCAGGAGCCAGGGGTGACCCTAGCCTC
CCTCAAGCCTTGGACACAGTACGCAGTGTTTGTGCGGGCCATCACGCTAACCACTGAGGA
GGACAGCCCTCATCAAGGAGCCCAGAGTCCCATCGTCTACCTCCGAACGCTGCCTGCAG
gtaggcatttggagggtgcaagagtcagtcagacgcctgcatccatgagaacaggggagc
acaggcaccagaaatagagaagccggggcactgaacacctggcccacagaggctggaagg
ccagatgcttgagtcctagaaagaagggggagcatttgcctaggtccttgcggggctggg
EXON 9  168 bp
ggcctatggcagagaaggggaggacagaaacaaaacactgagttctaggaagccaggggt
gaggatcacctattctttgggagaacaaggctgttggaccccagaaaggagggctcatta
ctagatagtattcaggaggaagacccacacccctgagttgcatccttctcgcactcctag
CTCCCACGGTGCCCCAAGACGTCATCTCCACGTCCAACTCCTCCTCCCACCTCCTGGTGC
GCTGGAAGCCACCGACCCAGCGCAATGGGAACCTCACCTACTACCTGGTGCTGTGGCAGC
GGCTGGCAGAGGACGGCGACCTCTACCTCAATGACTACTGCCACCGCG
gtgcgcagggacgacgcgcaggccggccgcggggcgggtggggaaggggagatggaggcg
cagggccccggcaggtgggggggatcagaggcgggtagaccgcctgtcttactagtgtct
tcccgctgcggcgccaggcttgcggctgcccaccagcaacaacgatccgcgcttcgacgg
EXON 10  196 bp
gcagaggacggcgacctctacctcaatgactactgccaccgcggtgcgcagggacgacgc
gcaggccggccgcggggcgggtggggaaggggagatggaggcgcagggccccggcaggtg
ggggggatcagaggcgggtagaccgcctgtcttactagtgtcttcccgctgcggcgccag
GCTTGCGGCTGCCCACCAGCAACAACGATCCGCGCTTCGACGGCGAAGACGGGGATCCTG
AGGCCGAGATGGAGTCCGACTGCTGCCCTTGCCAGCACCCACCTCCTGGTCAGGTTCTGC
CCCCGCTGGAGGCGCAAGAGGCCTCGTTCCAGAAGAAGTTTGAAAACTTTCTACACAACG
CGATCACCATCCCCAT
gtgcgaagagcgcgcgcggcctgggagggtctgatgagtggggcctgtgaggggcgggtc
ttgcgggaggggtggggtttgtgggtggggccttgcttgtgtgggcgggtcccgggttgt
gggtgcttttggaggcggtacgcgctgcagagggcacaggggtgcatccggacaggcctg
EXON 11  42 bp
agggtctgatgagtggggcctgtgaggggcgggtcttgcgggaggggtggggtttgtggg
tggggccttgcttgtgtgggcgggtcccgggttgtgggtgcttttggaggcggtacgcgc
tgcagagggcacaggggtgcatccggacaggcctgatagggctactcctggcctccccag
ATCCCCTTGGAAGGTGACGTCCATCAACAAGAGCCCCCAAAG
gtgagcaggactagggcaggtgctgaggggcgtggctttgggggctgggccttggctctg
actcgctctccccagggactcagggcggcaccgccgggcagctgggcccctccggctggg
gggcaacagctcggatttcgagatccaggaggacaaggtgccccgtgagcgagcggtgct
EXON 12  221 bp
cgctgcagagggcacaggggtgcatccggacaggcctgatagggctactcctggcctccc
cagatccccttggaaggtgacgtccatcaacaagagcccccaaaggtgagcaggactagg
gcaggtgctgaggggcgtggctttgggggctgggccttggctctgactcgctctccccag
GGACTCAGGGCGGCACCGCCGGGCAGCTGGGCCCCTCCGGCTGGGGGGCAACAGCTCGGA
TTTCGAGATCCAGGAGGACAAGGTGCCCCGTGAGCGAGCGGTGCTGAGCGGCCTGCGCCA
CTTCACGGAATACCGGATCGACATCCATGCCTGCAACCACGCGGCGCACACCGTGGGCTG
CAGCGCCGCCACCTTCGTCTTTGCGCGCACCATGCCCCACA
gtaggtgatccacacacacaccttctacccccatcaccgaccccaaggaccctgtgcaaa
ggtttggggtttgacttctcgctaaccccagagcctcgctttgcttgcccctctcagttc
ccataatcccaaagctttccccacctcccagctcagcccagtttagcttgggtttgaaca
EXON 13  137 bp
tgtgcaaaggtttggggtttgacttctcgctaaccccagagcctcgctttgcttgcccct
ctcagttcccataatcccaaagctttccccacctcccagctcagcccagtttagcttggg
tttgaacataaggtgagatgaaccacttttggcccggctgctggatgccccttcccgcag
GAGAGGCTGATGGTATTCCAGGAAAGGTGGCCTGGGAGGCCTCCAGCAAGAACAGTGTCC
TTCTGCGCTGGCTCGAGCCACCAGACCCCAACGGACTCATCCTCAAGTACGAAATCAAGT
ACCGCCGCTTGGGAGAG
gtaggtgcccgtgggacccccgtcccagccccgttttgtgcctacatcgccttcccagcc
agctgttctgcgttactctcaggaggccacagtgctgtgtgtgtcccgtcttcgatatgc
gaagtttgggggagtccacctggccctgctgccccctggaaactactctgccagggttag
EXON 14  163 bp
cctccagcaagaacagtgtccttctgcgctggctcgagccaccagaccccaacggactca
tcctcaagtacgaaatcaagtaccgccgcttgggagaggtaggtgcccgtgggacccccg
tcccagccccgttttgtgcctacatcgccttcccagccagctgttctgcgttactctcag
GAGGCCACAGTGCTGTGTGTGTCCCGTCTTCGATATGCGAAGTTTGGGGGAGTCCACCTG
GCCCTGCTGCCCCCTGGAAACTACTCTGCCAGGGTTAGGGCAACCTCACTGGCTGGCAAT
GGCTCTTGGACAGACAGTGTTGCCTTCTACATCCTTGGCCCAG
gtatacacagcctctgtcacagacctgtatcaccgaacagccctacctggtccccagccc
accacaggcccctcccccgcatccctccccatcctcacctcccagcatggaaagagaagc
atgaccttccctctgacttctacatctttgactctaccctctgctgccctctgactgcca
EXON 15  106 bp
tatacacagcctctgtcacagacctgtatcaccgaacagccctacctggtccccagccca
ccacaggcccctcccccgcatccctccccatcctcacctcccagcatggaaagagaagca
tgaccttccctctgacttctacatctttgactctaccctctgctgccctctgactgccag
AGGAGGAGGATGCTGGGGGGCTGCATGTCCTCCTCACTGCCACCCCTGTGGGGCTCACGC
TGCTCATCGTTCTTGCTGCCCTTGGTTTCTTCTACGGCAAGAAGAG
gtgatgataagtcccaccggtccccacccccttttctccctgagccctcatcataaagtc
tgtcaaagggaggtagatgagacagtagaaagacaggtcttccatacaggcagtaactct
tcccctgcggtggcacagaggaaacatacctctcagttagggtgaccaactcatcccggt
EXON 16  53 bp
aggaatagggccaaggccaacttggagggtacttagggatccccaggagtcaccctgacc
aaggctgggggtgtggtcagtaacttccctcctccttgaaatgtccttcttccttcttct
gatgttgctcattccttcctgagaacccttccagcctgaccccctcacctcccgttgcag
AAACAGAACCCTGTATGCTTCTGTGAATCCAGAGTACTTCAGCGCCTCTGATA
gtaggtctgggagtgggtggacaggtggtgtgggaaagggagacaggagaggagcagaga
cagacttccagaagaccttcttgcagaagatagccttgggacaagagcccttcagaagag
gagaagagaagttggggggtgaggtgtggcagagagcagcatcctcgctttgtgaccctc
EXON 17  230 bp
tgggtggacaggtggtgtgggaaagggagacaggagaggagcagagacagacttccagaa
gaccttcttgcagaagatagccttgggacaagagcccttcagaagaggagaagagaagtt
ggggggtgaggtgtggcagagagcagcatcctcgctttgtgaccctccacctccttgcag
TGTATGTCCCTGATGAATGGGAGGTGCCTCGGGAGCAGATCTCGATAATCCGGGAACTGG
GCCAGGGCTCTTTTGGGATGGTATATGAGGGGCTGGCACGAGGACTTGAGGCTGGAGAGG
AGTCCACACCCGTGGCCCTGAAGACGGTGAATGAGCTGGCCAGCCCACGGGAATGCATTG
AGTTCCTCAAGGAAGCTTCTGTCATGAAAGCCTTCAAGTGTCACCATGTG
gtaagggagagccaagggcattgtcagggtcataattagtgtaaaggtcatgtggtaaga
aagaaagggtcagagatgaggttagggcaccattaaggtcaagattgggaccatggttag
gatcctaattggggtaaaggtcatggttagggttagagtcaaacagggtcatagtagggc
EXON 18  111 bp
atgatgaaggtcatgggttagggtcagggtcattgttaggtcaggagtcaggttatagtc
atggttggggttagggtcaggtttggtgtctgagtcagactgtggtcatagcagatcaga
attttggccaaatgggtcaaggggaactagggggtctgctaggccctttgtctgtcccag
GTGCGTCTCCTGGGTGTGGTATCTCAGGGCCAGCCAACTCTGGTCATCATGGAGTTAATG
ACCCGTGGGGACCTCAAGAGCCATCTTCGATCTTTGCGGCCTGAGGCAGAG
gtagggaccaggaagaccctggggagtgaaagaagggttgggcacagtgtgggaggtggg
ggccagttctggacaggagaccagcctctgggttccttcctcaccagcccccaatcttgg
ctctagaacaaccctgggctcccacagccagcattgggggaaatgatccaaatggctggt
EXON 19  160 bp
atgacccgtggggacctcaagagccatcttcgatctttgcggcctgaggcagaggtaggg
accaggaagaccctggggagtgaaagaagggttgggcacagtgtgggaggtgggggccag
ttctggacaggagaccagcctctgggttccttcctcaccagcccccaatcttggctctag
AACAACCCTGGGCTCCCACAGCCAGCATTGGGGGAAATGATCCAAATGGCTGGTGAGATT
GCAGACGGCATGGCCTACCTTGCTGCCAACAAGTTTGTGCACCGAGATCTAGCAGCCCGC
AACTGCATGGTGTCCCAGGACTTCACCGTCAAGATCGGGG
gtacagagggtgccaggcagatgagggcggcctgaaaagtagagagactcccttaagcta
ggcatcaggagacccacagccctggtcctgacagcctgtgagacccttggcaagtcaccc
ccaccctgtatcttagtctcttgtccaagggcagaggggtttggatgggatgagttctga
EXON 20  130 bp
ctcttgtccaagggcagaggggtttggatgggatgagttctgaggtccattgagccccta
ctttccagggttcttggtgactctggaggatgagaagattgggagaggtatcccaggggc
aggagctagtgcgtggctcttatgccccacacctcctccaccctcaccctcactttccag
ACTTCGGGATGACTCGGGACGTGTATGAGACAGACTATTACCGCAAGGGTGGGAAGGGGC
TGCTGCCCGTGCGCTGGATGGCCCCCGAGTCCCTCAAAGATGGGATCTTCACCACCCACT
CGGATGTCTG
gtggggccgagctggagcacagggctccagggatgtggaggcgggatctggggaggggcc
tggaacacccccatcccttggaatgcactgagtagcacgaagggtgctgggctcaggagc
tcctgcatgcccccaggtcctttggcgtggtactctgggagattgtgaccctggcagaac
EXON 21  135 bp
gagtccctcaaagatgggatcttcaccacccactcggatgtctggtggggccgagctgga
gcacagggctccagggatgtggaggcgggatctggggaggggcctggaacacccccatcc
cttggaatgcactgagtagcacgaagggtgctgggctcaggagctcctgcatgcccccag
GTCCTTTGGCGTGGTACTCTGGGAGATTGTGACCCTGGCAGAACAACCCTACCAGGGCCT
GTCCAATGAGCAGGTGCTGAAGTTCGTCATGGATGGCGGGGTCCTGGAGGAGCTGGAGGG
CTGTCCCCTTCAGCT
gtgagtcacctcccctgccccttcctcattgttgatctacctacaaccctcccccacccg
gccccatgattctggctcacctcctctgatgctttgacatccactgaccctcagctatga
gcgccacccccctatcccaaacccccaagactcccatttaatcccttctcaccctcccag
EXON 22  232 bp
ctcagctatgagcgccacccccctatcccaaacccccaagactcccatttaatcccttct
caccctcccaggcataatggcccacgatccccactcccaccaactgaccctcagtgcagg
aggctgagagcgtggcaggggctcccggatgcctctgaccctgctccccacacccaccag
GCAGGAGCTGATGAGCCGCTGCTGGCAGCCGAACCCACGCCTGCGCCCATCTTTCACACA
CATTCTGGACAGCATACAGGAGGAGCTGCGGCCCTCCTTCCGCCTCCTCTCCTTCTACTA
CAGCCCGGAATGCCGGGGGGCCCGGGGCTCCCTGCCTACCACCGATGCAGAGCCTGACTC
CTCACCCACTCCAAGAGACTGCAGCCCTCAAAATGGGGGTCCAGGGCACTGA
ggggcacctcattccctggctggcctcccatggggagacaggaagggacccgacctctgt
ggctgagacgcctgaatgttcacccccaccccaactcagggcaagggatggccgagggtg
gggcagagaacaggagcagggaaggctgtgggggtgggcagaggggtctcaccataggag