Gene IL24 Variant 2
DNA : 6.70 KbNT_021877
mRNA : 1633 bp NM_181339
CDS : 147 bp NP_851936
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  172 bp
catctcacctcaggggctgctttccccatcgctgtattgtccttaaagtgatgggtgact
aggcaatgaagtaattctctaggaaagcatgaccaatttccctttctccacctccctctt
tttcctccacccctcccccatcagcccccatatatatgcccaaatctccacaaagccttg
CTTGCCTGCAAACCTTTACTTCTGAAATGACTTCCACGGCTGGGACGGGAACCTTCCACC
CACAGCTATGCCTCTGATTGGTGAATGGTGAAGGTGCCTGTCTAACTTTTCTGTAAAAAG
AACCAGCTGCCTCCAGGCAGCCAGCCCTCAAGCATCACTTACAGGACCAGAG
gtgagcatgggggattcttggttacttttttttgaaggactagacctctgctttatttgt
gaaaaggggtcaaggtggggacagcagaagtcaatttttttgagtgttgatgtagggaca
agacatgactgtgatgaggagctgctttcgccaatttaacaccaagaagaattgaggctg
EXON 2  63 bp
tctcccctccccatgggccagctcagcccagtccttcctgggtcctcttttggtccctct
ggcctttgagatctcacagactagatagatttaggggtctagggaagcagcacatatttg
cagagttggtttctatgctgacccctaacctggagacgtcttttctttctgtttgccaag
CAAGCTCAGGATAACATCACGAGTGCCCGGCTGCTGCAGCAGGAGGTTCTGCAGAACGTC
TCG
gtaatcagacctcggggacaccaccctctgtgggacgggtctactgtgggtgggagtgca
aggctttcttaggggaggttgatgaaagcccttcacttcttccctggactgaccttacac
aggacagggccagactgtgagccagggaagtcagtgtctggggttattgctatgtggtat
EXON 3  159 bp
aacaaagacctgctctccatggcccctgaaggctcctacagatctaaggttcatcatcac
cttctagaagatccctatctctgctgtgcttatcttgccttgggtggcatgtgggttgtt
ccttcagggggtcagggtgggcagaggccttggctcagcagtgacccagaccttccccag
GATGCTGAGAGCTGTTACCTTGTCCACACCCTGCTGGAGTTCTACTTGAAAACTGTTTTC
AAAAACTACCACAATAGAACAGTTGAAGTCAGGACTCTGAAGTCATTCTCTACTCTGGCC
AACAACTTTGTTCTCATCGTGTCACAACTGCAACCCAGT
gtgagtagcacacgctctggatactggcagctctgggttcaagtctaggtctgcttccaa
tctgctgggtgaccctctgcaaagtcctccacctccctgggcttcagtttgttatctgta
aaatggggatgatcactcctgcctggcaggattgctgcgagaattaaaggaggtagcccc
EXON 4  75 bp
aaaggaggtagcccctttcacaaggtgggagtttggtattggttaccttggggaatgcag
gattcagccctgggctctcaggctttgggagaccctgtggcatcagcaggaaaactgaga
gggagtttgcatctgctcctatctaaaaattggcacaacttcttttcccatgttatgtag
CAAGAAAATGAGATGTTTTCCATCAGAGACAGTGCACACAGGCGGTTTCTGCTATTCCGG
AGAGCATTCAAACAG
gtaaggccaagagctgagagcttgcccatccagcagaatagactagtctgcaccatcaca
cgagggcgcctcagagacccaatgcagaatgtaatgcaggggacaccatcagctttgctc
caaagccccctgacttagcaggagcacagttatatttgcagaagcatcgtaaactaagtg
EXON 5  1164 bp
aagcagataaacacatgtagatggaggaaaagtgacaggcaggtgggttcatcagtgggc
tcatcccaaaggtgacccatcccttggattggagtcaggtctattttaggcatggcaggt
tggaagaaagactattctcatagctaacatggctgaccttcaaccctcttttccctttag
TTGGACGTAGAAGCAGCTCTGACCAAAGCCCTTGGGGAAGTGGACATTCTTCTGACCTGG
ATGCAGAAATTCTACAAGCTCTGAATGTCTAGACCAGGACCTCCCTCCCCCTGGCACTGG
TTTGTTCCCTGTGTCATTTCAAACAGTCTCCCTTCCTATGCTGTTCACTGGACACTTCAC
GCCCTTGGCCATGGGTCCCATTCTTGGCCCAGGATTATTGTCAAAGAAGTCATTCTTTAA
GCAGCGCCAGTGACAGTCAGGGAAGGTGCCTCTGGATGCTGTGAAGAGTCTACAGAGAAG
ATTCTTGTATTTATTACAACTCTATTTAATTAATGTCAGTATTTCAACTGAAGTTCTATT
TATTTGTGAGACTGTAAGTTACATGAAGGCAGCAGAATATTGTGCCCCATGCTTCTTTAC
CCCTCACAATCCTTGCCACAGTGTGGGGCAGTGGATGGGTGCTTAGTAAGTACTTAATAA
ACTGTGGTGCTTTTTTTGGCCTGTCTTTGGATTGTTAAAAAACAGAGAGGGATGCTTGGA
TGTAAAACTGAACTTCAGAGCATGAAAATCACACTGTCTTCTGATATCTGCAGGGACAGA
GCATTGGGGTGGGGGTAAGGTGCATCTGTTTGAAAAGTAAACGATAAAATGTGGATTAAA
GTGCCCAGCACAAAGCAGATCCTCAATAAACATTTCATTTCCCACCCACACTCGCCAGCT
CACCCCATCATCCCTTTCCCTTGGTGCCCTCCTTTTTTTTTTATCCTAGTCATTCTTCCC
TAATCTTCCACTTGAGTGTCAAGCTGACCTTGCTGATGGTGACATTGCACCTGGATGTAC
TATCCAATCTGTGATGACATTCCCTGCTAATAAAAGACAACATAACTCAAGTCTGGCAGA
CTTTCTTCTCTATTTCTGGATGAATGCCCAGTGAGACTGTGTTGTACAGCTAGAAAAGGC
CTTCTTCCCAATAGCAAGGCTGTGCATCTAGCCTCAAGCTCTGGCTGAACTTTGTGGTCG
ACATCAATCTAAAGATACAGTGTCTGACTATAACCTTGTTCCAAAAACCTAGGCAAAGAG
TATATGTAGGAGGTGGGATATCACTTCCATGACATAAGTGCTATTGCAGAGCCGTGGCCA
CCCAGGAACTCCTGACTGCTTTCC
ttcccctgcttgctatacattgtctggaactggctaagaaatggggaacatttgtgaaaa
ccaagaaatgtaatggttttggatgaataaaatagaccaaagttaaggtaagtgcacaaa
tatcagtgtcaggctatggaagaaagataaagagatacttttttttttttttttttagag