Gene IL24 Variant 1
DNA : 6.70 KbNT_021877
mRNA : 1975 bp NM_006850
CDS : 621 bp NP_006841
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  172 bp
catctcacctcaggggctgctttccccatcgctgtattgtccttaaagtgatgggtgact
aggcaatgaagtaattctctaggaaagcatgaccaatttccctttctccacctccctctt
tttcctccacccctcccccatcagcccccatatatatgcccaaatctccacaaagccttg
CTTGCCTGCAAACCTTTACTTCTGAAATGACTTCCACGGCTGGGACGGGAACCTTCCACC
CACAGCTATGCCTCTGATTGGTGAATGGTGAAGGTGCCTGTCTAACTTTTCTGTAAAAAG
AACCAGCTGCCTCCAGGCAGCCAGCCCTCAAGCATCACTTACAGGACCAGAG
gtgagcatgggggattcttggttacttttttttgaaggactagacctctgctttatttgt
gaaaaggggtcaaggtggggacagcagaagtcaatttttttgagtgttgatgtagggaca
agacatgactgtgatgaggagctgctttcgccaatttaacaccaagaagaattgaggctg
EXON 2  146 bp
tttctgtaaaaagaaccagctgcctccaggcagccagccctcaagcatcacttacaggac
cagaggtgagcatgggggattcttggttacttttttttgaaggactagacctctgcttta
tttgtgaaaaggggtcaaggtggggacagcagaagtcaatttttttgagtgttgatgtag
GGACAAGACATGACTGTGATGAGGAGCTGCTTTCGCCAATTTAACACCAAGAAGAATTGA
GGCTGCTTGGGAGGAAGGCCAGGAGGAACACGAGACTGAGAGATGAATTTTCAACAGAGG
CTGCAAAGCCTGTGGACTTTAGCCAG
gtgcggtggctcacacctgtaatcccagaactttgggaggctgaggtgggcagatcattt
aaggtcaggagttcgagaccagcctggccaacatggtgaaaccctgtctctactaaaaat
acaaaaaaaaattagttgggcatgtgtttttgatattttcagatacaaaaatcccagcta
EXON 3  196 bp
gaaagacccctgcttcacccccactgcaccttagcaaggctgccggtttgcaatagtctc
aacttgcccattggagagtgctcgagattggcccggggagaccctcggagcattttccca
gggcatgtaactctgggtcagagggccggcctcacaggctgcctccctttctttcagcag
ACCCTTCTGCCCTCCTTTGCTGGCGACAGCCTCTCAAATGCAGATGGTTGTGCTCCCTTG
CCTGGGTTTTACCCTGCTTCTCTGGAGCCAGGTATCAGGGGCCCAGGGCCAAGAATTCCA
CTTTGGGCCCTGCCAAGTGAAGGGGGTTGTTCCCCAGAAACTGTGGGAAGCCTTCTGGGC
TGTGAAAGACACTATG
gtgagtaaagtgctgttctggacccagtcgtgggggttcctgggggcagtgggccagtgg
ggcgaggggatgctattttatgattctggagtccttcacagcttgctaatcagtttccag
tttcccatataataactctgtgaggtcagaaggcaccacaagccccatttacacatgagg
EXON 4  63 bp
tctcccctccccatgggccagctcagcccagtccttcctgggtcctcttttggtccctct
ggcctttgagatctcacagactagatagatttaggggtctagggaagcagcacatatttg
cagagttggtttctatgctgacccctaacctggagacgtcttttctttctgtttgccaag
CAAGCTCAGGATAACATCACGAGTGCCCGGCTGCTGCAGCAGGAGGTTCTGCAGAACGTC
TCG
gtaatcagacctcggggacaccaccctctgtgggacgggtctactgtgggtgggagtgca
aggctttcttaggggaggttgatgaaagcccttcacttcttccctggactgaccttacac
aggacagggccagactgtgagccagggaagtcagtgtctggggttattgctatgtggtat
EXON 5  159 bp
aacaaagacctgctctccatggcccctgaaggctcctacagatctaaggttcatcatcac
cttctagaagatccctatctctgctgtgcttatcttgccttgggtggcatgtgggttgtt
ccttcagggggtcagggtgggcagaggccttggctcagcagtgacccagaccttccccag
GATGCTGAGAGCTGTTACCTTGTCCACACCCTGCTGGAGTTCTACTTGAAAACTGTTTTC
AAAAACTACCACAATAGAACAGTTGAAGTCAGGACTCTGAAGTCATTCTCTACTCTGGCC
AACAACTTTGTTCTCATCGTGTCACAACTGCAACCCAGT
gtgagtagcacacgctctggatactggcagctctgggttcaagtctaggtctgcttccaa
tctgctgggtgaccctctgcaaagtcctccacctccctgggcttcagtttgttatctgta
aaatggggatgatcactcctgcctggcaggattgctgcgagaattaaaggaggtagcccc
EXON 6  75 bp
aaaggaggtagcccctttcacaaggtgggagtttggtattggttaccttggggaatgcag
gattcagccctgggctctcaggctttgggagaccctgtggcatcagcaggaaaactgaga
gggagtttgcatctgctcctatctaaaaattggcacaacttcttttcccatgttatgtag
CAAGAAAATGAGATGTTTTCCATCAGAGACAGTGCACACAGGCGGTTTCTGCTATTCCGG
AGAGCATTCAAACAG
gtaaggccaagagctgagagcttgcccatccagcagaatagactagtctgcaccatcaca
cgagggcgcctcagagacccaatgcagaatgtaatgcaggggacaccatcagctttgctc
caaagccccctgacttagcaggagcacagttatatttgcagaagcatcgtaaactaagtg
EXON 7  1164 bp
aagcagataaacacatgtagatggaggaaaagtgacaggcaggtgggttcatcagtgggc
tcatcccaaaggtgacccatcccttggattggagtcaggtctattttaggcatggcaggt
tggaagaaagactattctcatagctaacatggctgaccttcaaccctcttttccctttag
TTGGACGTAGAAGCAGCTCTGACCAAAGCCCTTGGGGAAGTGGACATTCTTCTGACCTGG
ATGCAGAAATTCTACAAGCTCTGAATGTCTAGACCAGGACCTCCCTCCCCCTGGCACTGG
TTTGTTCCCTGTGTCATTTCAAACAGTCTCCCTTCCTATGCTGTTCACTGGACACTTCAC
GCCCTTGGCCATGGGTCCCATTCTTGGCCCAGGATTATTGTCAAAGAAGTCATTCTTTAA
GCAGCGCCAGTGACAGTCAGGGAAGGTGCCTCTGGATGCTGTGAAGAGTCTACAGAGAAG
ATTCTTGTATTTATTACAACTCTATTTAATTAATGTCAGTATTTCAACTGAAGTTCTATT
TATTTGTGAGACTGTAAGTTACATGAAGGCAGCAGAATATTGTGCCCCATGCTTCTTTAC
CCCTCACAATCCTTGCCACAGTGTGGGGCAGTGGATGGGTGCTTAGTAAGTACTTAATAA
ACTGTGGTGCTTTTTTTGGCCTGTCTTTGGATTGTTAAAAAACAGAGAGGGATGCTTGGA
TGTAAAACTGAACTTCAGAGCATGAAAATCACACTGTCTTCTGATATCTGCAGGGACAGA
GCATTGGGGTGGGGGTAAGGTGCATCTGTTTGAAAAGTAAACGATAAAATGTGGATTAAA
GTGCCCAGCACAAAGCAGATCCTCAATAAACATTTCATTTCCCACCCACACTCGCCAGCT
CACCCCATCATCCCTTTCCCTTGGTGCCCTCCTTTTTTTTTTATCCTAGTCATTCTTCCC
TAATCTTCCACTTGAGTGTCAAGCTGACCTTGCTGATGGTGACATTGCACCTGGATGTAC
TATCCAATCTGTGATGACATTCCCTGCTAATAAAAGACAACATAACTCAAGTCTGGCAGA
CTTTCTTCTCTATTTCTGGATGAATGCCCAGTGAGACTGTGTTGTACAGCTAGAAAAGGC
CTTCTTCCCAATAGCAAGGCTGTGCATCTAGCCTCAAGCTCTGGCTGAACTTTGTGGTCG
ACATCAATCTAAAGATACAGTGTCTGACTATAACCTTGTTCCAAAAACCTAGGCAAAGAG
TATATGTAGGAGGTGGGATATCACTTCCATGACATAAGTGCTATTGCAGAGCCGTGGCCA
CCCAGGAACTCCTGACTGCTTTCC
ttcccctgcttgctatacattgtctggaactggctaagaaatggggaacatttgtgaaaa
ccaagaaatgtaatggttttggatgaataaaatagaccaaagttaaggtaagtgcacaaa
tatcagtgtcaggctatggaagaaagataaagagatacttttttttttttttttttagag