Gene IL22RA1 Variant 1
DNA : 23.35 KbNT_077383
mRNA : 2798 bp NM_021258
CDS : 1725 bp NP_067081
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  82 bp
ggaagggaactcccttagatcccgcccagaacctggaattccagagcacacagggccagg
acacctttgtacccctgctccccaccggcacaggtcccacccacccccttctccccgccc
catgcccgggtggagccagctgccagggcgccaagactcccagccctctctctgtgcacg
GCAGAGTAGAGGCCAAGGGAGGGCTCTGTGCCAGCCCCGATGAGGACGCTGCTGACCATC
TTGACTGTGGGATCCCTGGCTG
gtgagtgcccatctaccctgtggtcagacctcccttatcccaggggccaacgatcagggt
catctccccagcaccctccccagcccgagcatagccagtttcagtttctcccctgctagg
gctgagcagggtgccgggtgttcacggagaagcaaatgcccagcttagtttgctgggggc
EXON 2  133 bp
tgctggtccatttgtagaaggctgggggccagggtctccctgcccacccaccaggctggc
atcttgaaagcaaaggcactttgcatgaaatttatatggggcaggactctgactgagccc
atacatgggcagggtgaccctgggaaagcccctgctcaccctcctcccaccctcctgcag
CTCACGCCCCTGAGGACCCCTCGGATCTGCTCCAGCACGTGAAATTCCAGTCCAGCAACT
TTGAAAACATCCTGACGTGGGACAGCGGGCCGGAGGGCACCCCAGACACGGTCTACAGCA
TCGAGTATAAGAC
gtaggcttctctcttgaccccacctcctttgactgatctgaagccagcccctctccaagg
aattcccctcctctccatatgttcccatgtccccaccaggactggtgtcacatagcccct
cccagataaagctttgctcctttatgtttcttttgcagagggagaataatataagggtaa
EXON 3  179 bp
agaagaatgcatatgcctcagagaatcattgtgagaacaaaatgagatcattcgcataaa
gggcctgggccactgaacgtgctaagtaaatatcagatctccttggcattattaataagc
cacaggcctagcgctggccttttcatcaccacggtgacttggccccttcctgacctgcag
GTACGGAGAGAGGGACTGGGTGGCAAAGAAGGGCTGTCAGCGGATCACCCGGAAGTCCTG
CAACCTGACGGTGGAGACGGGCAACCTCACGGAGCTCTACTATGCCAGGGTCACCGCTGT
CAGTGCGGGAGGCCGGTCAGCCACCAAGATGACTGACAGGTTCAGCTCTCTGCAGCACA
gtgagttggagcccctgtgggtttcaggggagggaagaggaaagcgcaggtgtttgcggg
gtgggatggcctcttcccctctggagtgggtggagggtccagaaggggctctctgcaagg
ggaggggcagctggggatgtggcttttagggaagccccccacccccaccaattacagtgt
EXON 4  176 bp
ccagggcttgtagaaacttttctcttttcactgtttgtttagccgttgctttcagaagca
tagctggcactggagtggaaggagagagggagcagtcattttccactgtccaaggttgcc
tcagacactacccaccgattctgactttttcttttctcttttctctctccctatccccag
CTACCCTCAAGCCACCTGATGTGACCTGTATCTCCAAAGTGAGATCGATTCAGATGATTG
TTCATCCTACCCCCACGCCAATCCGTGCAGGCGATGGCCACCGGCTAACCCTGGAAGACA
TCTTCCATGACCTGTTCTACCACTTAGAGCTCCAGGTCAACCGCACCTACCAAATG
gtgagtgtatgttgcaccctggtctttctctgcctaggaagcctcttccctcccaattag
atctgagttgctttaagaaaaaaaggggacatgttatgtaaattagcatttcccaaaaca
tgtcccttgagaggctccttgaagcctggaaatcatcacaaatgacaacttttctcttgt
EXON 5  139 bp
acgtgcttggagactgattggatttggggataaagcagaagggaggggaatggaaacaga
ggctgaagacagacccatcagcatcaaaccagaatccaggaggagcgagcaagcttcctt
gggctctatgtggagatcggtgtgtaacaggaatcacattccattctctgtccaattcag
CACCTTGGAGGGAAGCAGAGAGAATATGAGTTCTTCGGCCTGACCCCTGACACAGAGTTC
CTTGGCACCATCATGATTTGCGTTCCCACCTGGGCCAAGGAGAGTGCCCCCTACATGTGC
CGAGTGAAGACACTGCCAG
gtgagttcggctgaaaccagagggaggtggggctcccgaattcaagtcttgactcttctc
tttcctccctgtaaccaaggtgagacttggcaacactctagaaaaccatggaagggttat
cagtgtgttattgaagtcaatctttgtttatccataaaagagttggctgatgagttatca
EXON 6  122 bp
ctgactatttagatgtacagtatatggacttccatttgtgatcttgcattctgacggtag
gagaggccttgccagcccagccagagagggttttcagcatccacatgtggggccagaccc
aaccgggcccaggcagagcccagcctcacgcttccttctctggcccctttggtttcccag
ACCGGACATGGACCTACTCCTTCTCCGGAGCCTTCCTGTTCTCCATGGGCTTCCTCGTCG
CAGTACTCTGCTACCTGAGCTACAGATATGTCACCAAGCCGCCTGCACCTCCCAACTCCC
TG
gtgagccatccccccagggtgggagggagaggtccaggggagggcctgggctccgaggtc
cccagttgtccccaaaatgcagggatccacagacaaagcaggagatgggcctgctctctc
cattcacggagctcacagtcccagctaaagtcaacggacgtgtagcccagcaggtctcag
EXON 7  1967 bp
ttcagagaggcacttgcacctagaggagtctctgggaagcagatggggatatgggacaga
cgcatcttgaaaaagcccccagatgcctccctatggaggacctcacccacccacatcacc
agtagggagcttgggacttaccctaaccacaggggggtgactgttgtcgtccctgcacag
AACGTCCAGCGAGTCCTGACTTTCCAGCCGCTGCGCTTCATCCAGGAGCACGTCCTGATC
CCTGTCTTTGACCTCAGCGGCCCCAGCAGTCTGGCCCAGCCTGTCCAGTACTCCCAGATC
AGGGTGTCTGGACCCAGGGAGCCCGCAGGAGCTCCACAGCGGCATAGCCTGTCCGAGATC
ACCTACTTAGGGCAGCCAGACATCTCCATCCTCCAGCCCTCCAACGTGCCACCTCCCCAG
ATCCTCTCCCCACTGTCCTATGCCCCAAACGCTGCCCCTGAGGTCGGGCCCCCATCCTAT
GCACCTCAGGTGACCCCCGAAGCTCAATTCCCATTCTACGCCCCACAGGCCATCTCTAAG
GTCCAGCCTTCCTCCTATGCCCCTCAAGCCACTCCGGACAGCTGGCCTCCCTCCTATGGG
GTATGCATGGAAGGTTCTGGCAAAGACTCCCCCACTGGGACACTTTCTAGTCCTAAACAC
CTTAGGCCTAAAGGTCAGCTTCAGAAAGAGCCACCAGCTGGAAGCTGCATGTTAGGTGGC
CTTTCTCTGCAGGAGGTGACCTCCTTGGCTATGGAGGAATCCCAAGAAGCAAAATCATTG
CACCAGCCCCTGGGGATTTGCACAGACAGAACATCTGACCCAAATGTGCTACACAGTGGG
GAGGAAGGGACACCACAGTACCTAAAGGGCCAGCTCCCCCTCCTCTCCTCAGTCCAGATC
GAGGGCCACCCCATGTCCCTCCCTTTGCAACCTCCTTCCCGTCCATGTTCCCCCTCGGAC
CAAGGTCCAAGTCCCTGGGGCCTGCTGGAGTCCCTTGTGTGTCCCAAGGATGAAGCCAAG
AGCCCAGCCCCTGAGACCTCAGACCTGGAGCAGCCCACAGAACTGGATTCTCTTTTCAGA
GGCCTGGCCCTGACTGTGCAGTGGGAGTCCTGAGGGGAATGGGAAAGGCTTGGTGCTTCC
TCCCTGTCCCTACCCAGTGTCACATCCTTGGCTGTCAATCCCATGCCTGCCCACGCCACA
CACTCTGCGATCTGGCCTCAGACGGGTGCCCTTGAGAGAAGCAGAGGGAGTGGCATGCAG
GGCCCCTGCCATGGGTGCGCTCCTCACCGGAGCAAAGCAGCATGATAAGGACTGCAGCGG
GGGAGCTCTGGGGAGCAGCTTGTGTAGACAAGCGCGTGCTCGCTGAGCCCTGCAAGGCAG
AAATGACAGTGCAAGGAGGAAATGCAGGGAAACTCCCGAGGTCCAGAGCCCCACCTCCTA
ACACCATGGATTCAAAGTGCTCAGGGAATTTGCCTCTCCTTGCCCCATTCCTGGCCAGTT
TCACAATCTAGCTCGACAGAGCATGAGGCCCCTGCCTCTTCTGTCATTGTTCAAAGGTGG
GAAGAGAGCCTGGAAAAGAACCAGGCCTGGAAAAGAACCAGAAGGAGGCTGGGCAGAACC
AGAACAACCTGCACTTCTGCCAAGGCCAGGGCCAGCAGGACGGCAGGACTCTAGGGAGGG
GTGTGGCCTGCAGCTCATTCCCAGCCAGGGCAACTGCCTGACGTTGCACGATTTCAGCTT
CATTCCTCTGATAGAACAAAGCGAAATGCAGGTCCACCAGGGAGGGAGACACACAAGCCT
TTTCTGCAGGCAGGAGTTTCAGACCCTATCCTGAGAATGGGGTTTGAAAGGAAGGTGAGG
GCTGTGGCCCCTGGACGGGTACAATAACACACTGTACTGATGTCACAACTTTGCAAGCTC
TGCCTTGGGTTCAGCCCATCTGGGCTCAAATTCCAGCCTCACCACTCACAAGCTGTGTGA
CTTCAAACAAATGAAATCAGTGCCCAGAACCTCGGTTTCCTCATCTGTAATGTGGGGATC
ATAACACCTACCTCATGGAGTTGTGGTGAAGATGAAATGAAGTCATGTCTTTAAAGTGCT
TAATAGTGCCTGGTACATGGGCAGTGCCCAATAAACGGTAGCTATTT
cctgttgtgattttttttttaaactacgttacacaaggagtgaccccctcccccaattcg
gattggcttcagacacacctggcattttctcatgggcttaaatgacctggatttcctcag
gacaggcaaagccagaggggtctggggtgggaaagaggagggactgcagggccttctaga