Gene HPCAL4 Variant 1
DNA : 12.44 KbNT_032977
mRNA : 4259 bp NM_016257
CDS : 576 bp NP_057341
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  112 bp
cgcgggcaggcggggcgcgctcctgcggccgggcctcgccggccacccggtccccacctg
aaaccccgcctgccactccgctccagaggagccaatagccgtgcaacctgcccgggatgg
ggcggggcttatgcaaatagtgtcgccttcgggaggcacatagtgatacaagagctggaa
GGCGGCTCCGGCGCAGACCTTGGAGAGCACAGCTGCCGGCCCGCGAGCCAGCCTCGGTTC
CCGCGGCCCGCCGAGGCTCGGAGCCATCCAGCGACCCGGCGACCGGCCTCAG
gtaatgcgagtgggaccgggtcctcaaggcaacaaacccaccgggcggaggccctggccc
cctccccctccactctcccttcccatcctcatgtcctgccctgattcacctccctgaccc
gtggttccgccttaggcggcagcaactgaagagcccacccctgggcaggagaccccccac
EXON 2  170 bp
taggagaagaaacctacctgaatgcaggtgttgtgaggggagaggaggccccattatggg
ggagtgtcatgaggggaaggaacctgcaaccccgccctgtgtgtggcaggggagggggca
gctgtggctgaggcagggcctttccctggacccagtcggaggaatccctctgtcccacag
GCCCCGCCATGGGGAAGACCAACAGCAAGCTGGCCCCCGAGGTGCTGGAGGACCTTGTTC
AGAACACTGAGTTCAGCGAGCAGGAGCTGAAGCAGTGGTACAAGGGCTTCCTGAAGGACT
GCCCCAGCGGCATCCTCAACCTGGAGGAGTTTCAGCAGCTCTACATCAAG
gtgggcggccggcacctggtgtgagggagccaagtacccgggttgggggaggcgaggaac
cgggggtgagggaggcagggcaccctgggatgagaagaggcgaggcacccggggtgggag
gggaggcgaggcacccggggtgcgggggaggtgaggcacccggggtggcgggggcaaggc
EXON 3  216 bp
cggggtgggaggggaggcgaggcacccggggtgcgggggaggtgaggcacccggggtggc
gggggcaaggcacccggggtgggaggaggcgaggcacccggggtgcaggggaggttccct
gagatgggggcggggtgggcggggctgtcgctgcgccccaacccaccgcacccccctcag
TTCTTCCCCTACGGCGACGCCTCCAAGTTCGCGCAGCACGCTTTCCGCACCTTCGACAAG
AACGGCGACGGCACCATCGACTTCCGGGAGTTCATCTGCGCCCTGTCGGTCACCTCCCGC
GGCAGCTTCGAGCAGAAGCTCAACTGGGCCTTTGAGATGTACGACCTGGACGGCGACGGG
CGCATCACGCGCCTGGAGATGCTGGAGATCATCGAG
gtgcggggccgcgcgggcgctgctgttcccgaggccagcgcttcgccatccccgcccctg
cctccgcgctgctctcgggcttcggggcctccctgctgctccccagcctgcgatcccgcc
tcctaccaccccgctacaggcccgggctaaatgctttacccgacactcgacggggcggag
EXON 4  3761 bp
gaaactctgtttcaaaaaaaaaaagagttgctcattaaatatccagtcttaatgaccaca
tataccttccagtatcctcaccaacccccagtgttctccctgccagatccctttccttca
cccgctgcttctcggggccccttgtgggtgttcacacctccctcctccttccctcaccag
GCAATCTACAAGATGGTGGGCACCGTGATCATGATGCGCATGAACCAGGACGGGCTCACG
CCCCAGCAGCGTGTGGACAAGATCTTCAAGAAGATGGACCAGGATAAGGACGACCAGATT
ACATTGGAGGAGTTCAAGGAGGCAGCCAAGAGTGACCCATCCATTGTGTTGCTGCTGCAG
TGTGACATGCAGAAGTAGAAGCTGGTGAGGGGCAGGGTCCCTGGCCAGAAGGGGCATGGC
CACCTCCCAACCTGATGACCTCTCTGGCTGGCCTCCCAGGAGGAGGGACACTCCAGCCCC
CCTCTCTGGCCCACCCAGTCCTCTGCCCAAGCCCTTCCTCCCCTCCATCAAGATCTTTGA
GGGACCACCTCACCCTGCAAAAGAGACAGGTCCTCCAGTACCCTGTCTTCTAGCCCCACC
TCCCACTTGGCCAGAACCAATGTCCATTGGGCATAGGGGAGTTGGCTTTTGCCCCAGGAG
GTGAGGTTAAGGAGTTGGGGGCCTGGGGTTCTGGTTAGGAATTCTCTTGATCCTGGGATT
ATGCTTTATAGGATGTGGTCCCACAGGCCTGTCACAGGGCCAAATTGGGTCTGTCCATTC
CTGAGGCTCCAGATCCCATAAAGGGGGTCTCTTCCCCATCCCTTCTACTCTACCTGGCCC
TTCCAGCCCCAGCCTTTGGAGCGTTCATTCAGTCCTTTCTTCAGCTAATGATTACTGAGC
ACCTGTTTGGTGCTAAGGATATGGTCATTTACAAGACACATCTTGTGCCCTCTGGAAGCT
CATAGGGTTGTGAGGCAAACTTCCAGCCGTCAGGGTCTCAGCTAAGCAGAAGGTGCTGGA
AGGCTGGTTAGTCTGGGAGGAGCTATTTCATCTTCCAGCTCAGCTCCACACAAAGCTGCA
GAAGGACGAAATGAAAAGCATTTGGAAGTTTAGGAGCCACGTGAGTGAAAGTTTTAAGAA
AAATGAAATTTATGTCATACTTATTTTTTTAGTACCCTTTAAAGGAGCTACAGTCATTTT
ATTATTTCAGGAGGTTAAAATATACTCTATATTACTTGGTTTCTTATAAAATGATTAAAT
GAATAGAGAAAATATTAATTTTCAAGGGGAAAAAACCTGAGAAGAAAGGGAGAAAAGACC
ATGAAATTTACCAGATAACACTTTTTAAGACTAAGTCCTGAGCTGCCACTCTCAGCAGTT
TTTGCTGCTTCAGCTCTTCCTTTTTATTACCTTTTTCAATTCAACAAGCAACTTTCTGCT
ACATACTTACTCCGGTTGGGTGCTGACTTCAGGGACAGGAAAAAGCAAGGTTTGCAAAGA
GTGAAACTAGTGTATATTCCGTATCTTGGTAGTTCGTTTCTGGATTGGGTTTAGTTTCAG
AACTGGACTTGTTCCTTCACTGCCACAGAATCAGAAAGAGCTAGAAGAAAAGGCTCACCT
GGCCACTGTTTAGGCACCCAGACATAATTTATGGACGAAATGCCTAAAAATGTGCCAGGC
ATGCTCTGTTTGAGAGGCTTTTTCTAACCCCAAATCTTAGATCTGCCAGGTAGTTCAACA
TCTTCCAAGTGTGCTGGTTCTGCTTTCCAATGCCTGCTTCCCAATTTTGGATCCATGAGC
TATACAGCTGCATGCTTTGACTGCCGGAAAAATTAATCTTGCTTCTTCATCAGGTCTTTC
TCCTGTACTTGTGATCAGAAATTACCTTTGACGTGCAGTGACAGTTGATTTCCTCTTGAA
CTGCCGGTGAAAACAGTCTAGTACACAGGTGCTGTCAGCCCAGGGTGGGAGCAGGAAATG
ATTGCTGAGCCCGGGGCAGGGGAATTGCATCTGCAGGAAAGAGATGCAGCATGCTCCTCA
CTCCTGAGTGCCCACCTGTCCTGCTTCTCTGCAGGTGAAAACTCTGGGGGATGCTGATCA
ATAGAGCTTGGTCCCAAGCTCTACTGGGCCCTTGGAGGTAGCAAGGCCACTGGGTTGCTA
TCCTCTTGCTGGGGATAGCAACCACTGGTTTGCAACCACTGGGTTGCTATCCTTTTGCTA
TCCTCTTGCTCATGACCAGCCATATGGTGAGGCTGGGGAGTTCACATCCTCAGGCAGGAA
CTAGCAGTTGTTTATCCAGCAATGCCTCAAGGATGTTGCATTGCTCCCAGGAACTGGCTA
TTAGGTATGTCTTGTGCGGTCAGTCAGCATCACAGACACATAGATGCTCACCAGCCTGGC
TTAGCTGGGACCTAAATCTTCTGGTGAAAAGCTTTTCACTAAGTGAGGTTCCTTCCCTGC
AAATGCTGAATCTAGCCTAATTCGCAACCACACAGAATTTCATGGCTTTCAAAGGCTTGC
CATGTGCCCCATCTCATTCTATACTCACATCCCATGGAGGTGAGGATTTTCACTTCTTTT
CTCTAGACTTGGAAGCTGAGATTCAGAGAGGAAGCATCCCTTGTGCAAGATCACATAGTC
AGGAGGTGACACAGGGCTAAGACTTGAACCAAGGCTCTAAGAGGATTTCTTCTTTTCAGA
GTCTCTTCCCTGTCCATTTCTGTGACTAAGCTGTGCAGAGGTTGACAGCAGGGCAAGTTA
CATTGATATTCATCCTTTATAGGCTTCCTGCTAAAAAGCTTCTGAGATTGTGGTCTTCCA
AAAAAAATAGGAGCTTGGTTGAAGTCCCCACATTTTCAAGCACTCAGTGTTCTGCCTCTG
GCAGCTGTGCTAACAGCTCAGTGCTGTCCTGGGAGTCCTCTGACTCAGAACCCTCGAAGC
ATCCTGCATTGTCTTTACCCACCATCATCTTCACTAAGAGAAACATGCCTACCCATGAAG
GCGTGTTTGATTACTCCAGGCTTCTGGACACACATACCCATGGGTGATTTTTGCTCCTCA
GGCCCAATATTCTCAGACAGCCCAGCAGTGTGAACACACAATGCCAGGCCAGGAACTGGG
ACCACCATCTTGCTGATGGAAGGAACAACAGGTGGCCCAGGACATGCTCCTGCATACTCC
TGGGTGTCCCAGGGACTGTGTGCTCAGGAGCACTGTGGTAGAGCACTGGCCCTGCCTTGA
GAAGAGACACAGGTCTCCCGTCCCTGCACCAGCTGAGAGAGACTTGCCGCAAAGCACAAG
GCTGGCAGAGATTTATGTATGACTTGCACAGACACAAAAATATACAGACAATCAAAACAT
TGATATATTCAAACTCTCCTTTAAATTCCAATCTTATTGCAACAACTCTGTGAATTGCAA
GGTCCCAGAATCTGCCTTCTCACATACTCTACCCTCATTCATCCTTTTGGGCTAATTGAT
GAGCATCTTATTTCTTATCTCTAAAAATTATCAGCAAAGGCTACTTCAGATGGCCACTTT
AGTCCTTTCAGCTGTAGTCAGGATTATTTAACTTACCTGTATATCAAAAGTGAAGAAAAA
GTTAGTTCATAAGTAAAGGCACTAAATCCTTTCCTGACAATGGCAGAGTCTCTAGAGGTA
GAAATTTGCCTTGCTGCAGAGAGAGAAGGAATGGCGTGGGATGGGGGAAAGAAAAGAAAG
AGAAGAAGCTGGGGTCTCCAGGCAGGGTAGTAAGCTGACACTAAATATTTTTTACACAAA
AATGTATTGAAGCAACAAATATTTCCTGAAGATCCACCCTGGGTGAGGCTTTGAGCTGAC
TTTAGAGATCACTGTGGGGTCAAGAATGTCTTACATGTTTTATTCATCATTCTTGAAAAA
AGAAATAATTCAAACCTTGGAATTAAAAAGTCAGAAAAATA
tgggattttctttctggaattttcgaggttttctttttacctttgccagagtgtgggggc
aggactgggcctgccagggtgtatagcccttcctgcttggtggaggccagtcaggcccag
ggccttctaagcagcagtagaaaggaggcttggggaagtggggggtctgggtagcagggg