Gene GPA33 Variant 1
DNA : 37.79 KbNT_004668
mRNA : 2793 bp NM_005814
CDS : 960 bp NP_005805
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  387 bp
atctcttgcgcactgtggggtggaggctgtagaagaggagagaagtagagaaacagatca
cattgtgtcttgaagtgtttcagcaaatatgggcaacacccttcttttactagcttggaa
ccctacctctgagtgcatttccctttttattatttatttcctgtcagttataagagaggc
CTACCCCTTTGTGAGCAGTCTAGGACTTTGTACACTTGTTAAGTAGGGAGAAGGCAGGGG
AGGTGGCTGGTTTAAGGGGAACTTGAGGGAAGTAGGGAAGACTCCTCTTGGGACCTTTGG
AGTAGGTGACACATGAGCCCAGCCCCAGCTCACCTGCCAATCCAGCTGAGGAGCTCACCT
GCCAATCCAGCTGAGGCTGGGCAGAGGTGGGTGAGAAGAGGGAAAATTGCAGGGACCTCC
AGTTGGGCCAGGCCAGAAGCTGCTGTAGCTTTAACCAGACAGCTCAGACCTGTCTGGAGG
CTGCCAGTGACAGGTTAGGTTTAGGGCAGAGAAGAAGCAAGACCATGGTGGGGAAGATGT
GGCCTGTGTTGTGGACACTCTGTGCAG
gtgagtaggccccttttctctccagtgcccaggggtgggtgagacatggggacctagggc
tgaaggagaggctctgtcagagccttcccaggaagggcctccagcaacacagctgcgttc
ctgctgggccagaattacacattccggaccagtgcccagaatcagaatggtttttattta
EXON 2  155 bp
cctcatcgcagtcttggaggagaagctggttgccagggccaaggtggccaagatggctct
agctgtggctggaggtgcaagaacagccctggacattccctcagtggtcctgtgggcagt
gagtgggtatgtctgtccgtgtcgcttacttttcccttccactgcctactttctttccag
TCAGGGTGACCGTCGATGCCATCTCTGTGGAAACTCCGCAGGACGTTCTTCGGGCTTCGC
AGGGAAAGAGTGTCACCCTGCCCTGCACCTACCACACTTCCACCTCCAGTCGAGAGGGAC
TTATTCAATGGGATAAGCTCCTCCTCACTCATACG
gtaaggatactttacaagttcaggcaacatgggaatgattatcacctgaccaggacctct
tagaaggcaagcactatgaagtctttccataaatggtagaataaacactagcacccaggc
tggagtgggtggggagggagcagtgaatgttgggctcatggagggccagagtatgtcacc
EXON 3  217 bp
tatatataatacaagaaatccacaaatgggtagcacatatgcgagctatttgttctgagg
ggttggcaggtctgtgcttctgggccctggaaactgggggatgagggtagtcagggcagg
ctggaagcaccaggcaagggcctttgggtgaagacctggtgccatttcttctctctccag
GAAAGGGTGGTCATCTGGCCGTTTTCAAACAAAAACTACATCCATGGTGAGCTTTATAAG
AATCGCGTCAGCATATCCAACAATGCTGAGCAGTCCGATGCCTCCATCACCATTGATCAG
CTGACCATGGCTGACAACGGCACCTACGAGTGTTCTGTCTCGCTGATGTCAGACCTGGAG
GGCAACACCAAGTCACGTGTCCGCCTGTTGGTCCTCG
gtgagtgtcttcatgtctttcaggagttgtaggaagagggtgggcaggtggcagcacagg
gagaagagcccaggtgttgagacgaagccagaggcagcaacaaggagctaagactcctca
cctcgtccaggctgtcttcagcagagggaccgctcctccctttggaactaaacactattc
EXON 4  156 bp
tgaggccatattggggtgaattggttttacagcattccatctcactactcaactatggag
ttttctgcctgtgaacaaacaaggcagtatatgtgtgtggggggtgggtggggaggggtg
ggtggctgtcaccaagccccacctgcctcatgccttctctttggtctctcctctatatag
TGCCACCCTCCAAACCAGAATGCGGCATCGAGGGAGAGACCATAATTGGGAACAACATCC
AGCTGACCTGCCAATCAAAGGAGGGCTCACCAACCCCTCAGTACAGCTGGAAGAGGTACA
ACATCCTGAATCAGGAGCAGCCCCTGGCCCAGCCAG
gtaagggggcagtagggaaggcgggctccccacgtcaaagtgcaacacatgcagctgatt
ggctaggggctgcaacttgggttgaccgatcagatccccctgaaggccgcttgcttccct
acccatccctatccccctatccccacctctctaagcactggtttcttgtttttagacaga
EXON 5  120 bp
tcacattgtgggccctgcctggtttaagcgtcctgcagccctggaggtggacatggggct
ccggcctgaagaagctcagtggcagaggttgtgcttcccaaggagtccagacctcccatt
cctggctgtctccactccactgtagtgcctctcttcaccctgactcttcttcccctgcag
CCTCAGGTCAGCCTGTCTCCCTGAAGAATATCTCCACAGACACATCGGGTTACTACATCT
GTACCTCCAGCAATGAGGAGGGGACGCAGTTCTGCAACATCACGGTGGCCGTCAGATCTC

gtaagagcagcctgcggggggagggctgacaaacgccacaggataactggtgggggtcca
gaaagtcagctgagaccaccgtgaggaggaataggggaacctctctagggccacgcacct
gcaggttagctgtggtgacctaggcaggatgactctgtcccaggctcccctcactctgag
EXON 6  136 bp
tgtctctgtctgcacctccatcctgaagaatattcctgggccatggctggtcacattcct
ccaagaccatgcctttcatggagtgttaccagaagctggtagctgctgctcccctggctg
ggaggagacccggagctagcttagaagctcggcaagtgcagctgctctgtcctcttgcag
CCTCCATGAACGTGGCCCTGTATGTGGGCATCGCGGTGGGCGTGGTTGCAGCCCTCATTA
TCATTGGCATCATCATCTACTGCTGCTGCTGCCGAGGGAAGGACGACAACACTGAAGACA
AGGAGGATGCAAGGCC
gtgagtgtctgggctggtagcctgttggaagggtctggggagactggaaatatgcttccc
aattcctcacagcctcttctacttgcagcaccccttggggtatatcacccccattttgtg
ctgatgaaacaatgacctgtccaagccataaaatgtgcattgcagccccaggacctgcct
EXON 7  1622 bp
cgtggaacaagtctgtggcacctttactctcagcccagcctttcagcccagtgtcctctg
cagctggtgggtggggaggaggtctggaggctgctcttcctgtaatgcacatgaggccca
gctcccttgagggtccacctgagagcaaatccttcccctctgtcccctgctgccctgcag
GAACCGGGAAGCCTATGAGGAGCCACCAGAGCAGCTAAGAGAACTTTCCAGAGAGAGGGA
GGAGGAGGATGACTACAGGCAAGAAGAGCAGAGGAGCACTGGGCGTGAATCCCCGGACCA
CCTCGACCAGTGACAGGCCAGCAGCAGAGGGCGGCGGAGGAAGGGTTAGGGGTTCATTCT
CCCGCTTCCTGGCCTCCCTTCTCCTTTCTAAGCCCTGTTCTCCTGTCCCTCCATCCCAGA
CATTGATGGGGACATTTCTTCCCCAGTGTCAGCTGTGGGGAACATGGCTGGCCTGGTAAG
GGGGTCCCTGTGCTGATCCTGCTGACCTCACTGTCCTGTGAAGTAACCCCTCCTGGCTGT
GACACCTGGTGCGGGCCTGGCCCTCACTCAAGACCAGGCTGCAGCCTCCACTTCCCTCGT
AGTTGGCAGGAGCTCCTGGAAGCACAGCGCTGAGCATGGGGCGCTCCCACTCAGAACTCT
CCAGGGAGGCGATGCCAGCCTTGGGGGGTGGGGGCTGTCCTGCTCACCTGTGTGCCCAGC
ACCTGGAGGGGCACCAGGTGGAGGGTTTGCACTCCACACATCTTTCTTGAATGAATGAAA
GAATAAGTGAGTATGCTTGGGCCCTGCATTGGCCTGGCCTCCAGCTCCCACTCCCTTTCC
AACCTCACTTCCCGTAGCTGCCAGTATGTTCCAAACCCTCCTGGGAAGGCCACCTCCCAC
TCCTGCTGCACAGGCCCTGGGGAGCTTTTGCCCACACACTTTCCATCTCTGCCTGTCAAT
ATCGTACCTGTCCCTCCAGGCCCATCTCAAATCACAAGGATTTCTCTAACCCTATCCTAA
TTGTCCACATACGTGGAAACAATCCTGTTACTCTGTCCCACGTCCAATCATGGGCCACAA
GGCACAGTCTTCTGAGCGAGTGCTCTCACTGTATTAGAGCGCCAGCTCCTTGGGGCAGGG
CCTGGGCCTCATGGCTTTTGCTTTCCCTGAAGCCCTAGTAGCTGGCGCCCATCCTAGTGG
GCACTTAAGCTTAATTGGGGAAACTGCTTTGATTGGTTGTGCCTTCCCTTCTCTGGTCTC
CTTGAGATGATCGTAGACACAGGGATGATTCCCACCCAAACCCACGTATTCATTCAGTGA
GTTAAACACGAATTGATTTAAAGTGAACACACACAAGGGAGCTTGCTTGCAGATGGTCTG
AGTTCTTGTGTCCTGGTAATTCCTCTCCAGGCCAGAATAATTGGCATGTCTCCTCAACCC
ACATGGGGTTCCTGGTTGTTCCTGCATCCCGATACCTCAGCCCTGGCCCTGCCCAGCCCA
TTTGGGCTCTGGTTTTCTGGTGGGGCTGTCCTGCTGCCCTCCCACAGCCTCCTTCTGTTT
GTCGAGCATTTCTTCTACTCTTGAGAGCTCAGGCAGCGTTAGGGCTGCTTAGGTCTCATG
GACCAGTGGCTGGTCTCACCCAACTGCAGTTTACTATTGCTATCTTTTCTGGATGATCAG
AAAAATAATTCCATAAATCTATTGTCTACTTGCGATTTTTTAAAAAATGTATATTTTTAT
ATATATTGTTAAATCCTTTGCTTCATTCCAAATGCTTTCAGTAATAATAAAATTGTGGGT
GG
aaattcttatttcttttttaatgtggattttgtttgcagtaagataaagcttgggtctca
tggatcatctctactcaccatagcactcttctgcttcctaggggaggtgagacaaggtaa
cagatttgagaatcctggggtccctctgcttgtggccgcagtagggtcaggcagtgcctc