Gene GLMN Variant 2
DNA : 52.50 KbNT_028050
mRNA : 1918 bp NM_053274
CDS : 1254 bp NP_009001
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  63 bp
ggaagagatccttgctcctacctgcggcttttcgagagcagcggggagccccggccttgc
ggccggcagaagacggcccagcgaagtccgccatgggggagagtagtctgccggacgggg
acacgctccggcgtctcgccccgaggccccgcctccctacgcgtagcgcggggcggggcc
AGAAGAGCGGGCTAAGACGCCGGAGGAGGTGGCGGCGGCTGGGAGAGGCGAGGGTTCTGG
CCG
gtaagtggagttgtggagaggttcagggtggccagggctcgcggttggccgtgagccgcg
gcggacttggtgctgcgggccgactaggccacgcgaggtggtggagcctgcccacctagg
cgagcaggaatcggaagacatggcttcctctgatgcagcccgcacgcgcgctggggtgtt
EXON 2  69 bp
aacatttcaactttaaaactttacattttctcctagcatgctattggaccaaaaaacaca
acaacaaaaactttccattttctttattgtatttactaataatttatcacactgaaacat
aacttttgaatacttaagtgtaatatcacggatagttaacagtgtgttttgtatttgtag
ATTTTAGCATCGAAACTAGGAGAAATAAGAATGGCTGTAGAGGAACTTCAGTCTATAATA
AAGAGATGT
gtaagtattaatttttgtaaaattaaatacctttcaaaatatgggaagggcacagattgt
ttttaattatatttgtggtcactcaaattgtttatcttctttaatccttgctttttttga
cctgtaaagagcatgagtgggggaggcagattggattatttctccaggtgacatacttat
EXON 3  126 bp
cttattaaagtatttattagggtaatcctaattttgatacgtgtgttatttacgttacat
ttatctagaatttaaacagatttccttttttcatagataaatcaagaagttattgtattt
aatttttatttgcatatacttttttttgtttgttttttgggttttttttttttttgccag
CAAATCCTAGAAGAGCAAGACTTTAAAGAAGAGGATTTTGGCCTATTTCAGTTAGCTGGG
CAAAGATGCATAGAAGAAGGGCACACAGACCAGCTATTAGAAATTATTCAAAATGAAAAG
AATAAG
gtgcgtacaatcttggtgtttacttttcagtcttgggaagagaataatcacatgatgcta
ttcatccagtcatttatccatcaaacatttaagaatctacttaaattttcacagtaggga
actgaaaacaaaaaaagaattagaaatatttaggccaggcgcagtggctcacgttcgtaa
EXON 4  120 bp
ttaaaaatgttgatgtctgttagtagccaaccctggaaagtctctggtgaaatgtcatag
gcttcacttgtctcatcttcctatttcagaaacaattctgagctcttccaagataggaaa
gcacactgcgagagtcctatagatggcagtgtttgctttactctgaaaatgtttttacag
GTCATCATCAAGAATATGGGCTGGAATCTCGTTGGTCCTGTTGTTCGATGCCTTTTGTGT
AAAGATAAAGAGGATAGTAAAAGAAAAGTTTATTTTTTGATCTTTGATTTATTGGTAAAG

gtaagttaacaaaacaaggttctctttatcataacacacagcagtattttataattccct
ttaatgtttattgtttggtaagaaagcttttggttcatgaaagtacatgcagaaaggaac
tcgttggagaaaagacccagtcttattgattggataggcaattccatttcaggatttccc
EXON 5  109 bp
catcacagattctgtgttttgctcatgcatattttttcaacaattgtataaataatttta
atgttaagcaaaaacataattgtataatattttgtcgatacatgccttcttaaaaatagt
aataatgtggctttaaatacaacttgtattaaacaggttcaattgtgaatatttttatag
TTATGCAATCCAAAGGAATTATTGTTGGGTTTGCTTGAACTGATTGAAGAGCCCTCTGGA
AAACAGATATCCCAAAGTATTCTTCTTTTGCTTCAGCCATTACAAACAG
gtaatgagaattttgatatcagagtacttcttgttgtatctctaaatgccttgatggtta
cctcaaaatgtcaatactacaccaaagtaaagtttacagctaattagtgagtactctgct
taaaccaataatagcaatgccaatgtgaatactgctgctcatagaaagattatagtatct
EXON 6  238 bp
tgtattattttatgcacaactaagaagaaaaaaacactgccaattagactgtgatgtgtc
atcttgattcaagagttgttaaaatgtgggaggaggaagtgtcttataattccacatttg
ccgaatttcttgtcccatgtttagcatacttgatgagcgacaacttgatctctgttttag
TGATTCAGAAACTTCATAACAAGGCATATTCAATTGGATTAGCATTGTCTACCCTTTGGA
ATCAGCTATCTCTTCTTCCTGTTCCATACTCAAAAGAACAAATACAAATGGATGACTATG
GCCTTTGTCAGTGTTGCAAGGCCTTAATAGAGTTCACTAAGCCTTTTGTGGAAGAAGTCA
TTGATAACAAAGAAAACTCACTGGAAAATGAAAAGTTAAAGGATGAATTACTGAAATT
gtaagtataattttaagaacatctcacagtggacttaagtaattgatagttcagttattt
tatgtttcttcactttgtttgacatgtaaatagaaatctagtttcagattttgaatttta
gaagaatgtggggttcagttgatacagcatgggaacttgagacatttatattttaaaaaa
EXON 7  103 bp
tggcctaattcccacctccttatggcagttaaatttcaacatgagttttggagagcagag
tcattcaaaccatagcagtgcttatgttatttttcaagtaaaattaacttagatttgaag
acctagggattttatacttggaagtgttgatttcatagttacctatttcttatgccttag
TTGTTTCAAAAGCTTGAAATGCCCTTTGCTGACAGCACAATTCTTTGAACAGTCTGAAGA
AGGTGGAAATGATCCTTTCAGGTATTTTGCATCAGAAATAATA
gtaagtacagctaatttaatctgctataatcttaaatgttatcccactatattctcagta
ctgcacatgtaaattgatacattcattaataaagaaatgtgtattttttgtagaacacac
ataaacaaaagatggaaaataaaacagcaataattttattatccaaagataaatattaac
EXON 8  188 bp
taatcatgggagtgacatcttggcgcattctgttggttgaaagcaagtctcataggtccc
actcacgctcaaagggagtgattacacctccccttggtgagaatgtggagtttgaataca
cggggtggggggcattttagagtctgtgtgctatggtttccttttttatccatttcatag
GGTTTTTTATCAGCAATTGGACACCCTTTCCCCAAAATGATTTTTAATCATGGAAGGAAA
AAGAGAACTTGGAATTACCTTGAATTTGAAGAAGAAGAAAATAAACAGTTAGCAGACTCA
ATGGCTTCTCTGGCATATCTAGTATTTGTACAGGGCATCCATATTGATCAGCTTCCAATG
GTCTTAAG
gtaagagttagtgtttggtttattcatgtattctaaaaggaatttcataaaattctcatt
tatctaatgtccaatatatgcatattaacacactaatacattttaaataaatagtaaagg
ctatttttaataagaatgatcccagctataatctgttaaagatagcagtagacaagtaat
EXON 9  54 bp
tttaaattgattacctccataaccctatctccaaataaggtcaaattctgaggtactaga
ggttaggactccaacatatcttttttgggggagatacaattcaacccataacaatatgta
tgtgtgtacatatctctgtgtgtgtgtataatatatatatttgttttgtttctattttag
CCCATTGTACCTTTTGCAGTTTAATATGGGGCACATTGAAGTCTTTTTGCAAAG
gtaagatcgtttagatggtatctcaaaatgaaatagtagtgttaaaatagtccttgttaa
gatcagcggagactgccttttctttgctaagctctaattaattaattggttattttataa
aacagcgaggcaaataattcacgagagagacagaaatgagtcaaggaggttttacaccaa
EXON 10  31 bp
accgaaagacagatcaaagatggattaaaacttttgatcaagttcttcaacagaatttct
ccttaatgatatgcattttaaaagtgttaaaatttcagtttttgctgtatttttcataag
atgaagtatcattctaaaatagtttacaaattcatgataaattttaatattatttttcag
AACAGAAGAGTCTGTTATCTCCAAAGGATTG
gtaagatgtttgttcccattataacttaaatacatagttatgtcaacaaataacagctgt
tgacttcactatatatgtatctgcatatattttaatctgtaggagctgctggagaatagt
ttattgagaatagaagacaatagtctactttaccagtacttagaaatcaagagttttctt
EXON 11  90 bp
ctaaaatagtttacaaattcatgataaattttaatattatttttcagaacagaagagtct
gttatctccaaaggattggtaagatgtttgttcccattataacttaaatacatagttatg
tcaacaaataacagctgttgacttcactatatatgtatctgcatatattttaatctgtag
GAGCTGCTGGAGAATAGTTTATTGAGAATAGAAGACAATAGTCTACTTTACCAGTACTTA
GAAATCAAGAGTTTTCTTACTGTACCTCAG
gtaaataaaatatgtattctaatattgaaaatagccctttgcctgttctgaacttaaagt
aaggtcttttctgattcctttcccactcttttctctgcaacctttgaaaactctggtgta
atgctgtccagtagaactttgacaatatgaaagccactagccaaactgaacacttgaaat
EXON 12  42 bp
aaaatcaattgtagttagctttctggaatggaaggcttagggaaaaattaatttacttca
cttttaaatctcctaccctcacttctctgaatttttagtatcctattgatgtattatagt
tgtttgtttgcagtcagtataatctgtttacatctgaattttacatttttttatttccag
GGCTTAGTGAAAGTAATGACACTTTGCCCCATTGAGACACTG
gtatgtaaatatttggtgactaaagaataatgagttacagtgagaaaatttgacaaataa
tttaattttctttttaaaaattttaatttgtgaaatttttatttaggaggtacaagtgtg
gatgtattacatgcataaaatggatagtgatgaagtctgggtaagctttattcattttat
EXON 13  74 bp
taatgagttacagtgagaaaatttgacaaataatttaattttctttttaaaaattttaat
ttgtgaaatttttatttaggaggtacaagtgtggatgtattacatgcataaaatggatag
tgatgaagtctgggtaagctttattcattttatataataatattgtttgttccattttag
AGGAAAAAGAGTTTAGCTATGCTTCAGCTGTATATTAACAAGTTGGATTCACAAGGCAAA
TATACATTATTTAG
gtatgtatcaagcatggctaattgctaagtgtgtggttgattaaaagtcatgttaatgcc
atgtaattgttttagggcatagtatgtcggtatgttttacatgtaattcaactctggttg
gaacccatattataaattctcagtgatggctagagaaagggttaatcaaatatttcagac
EXON 14  85 bp
gagcaataactattacaggtgactttgtaattggttgatgaccttgctaattaccattac
tgtggggtttttattcctagaagtaacacatggcctctttgaatttgtaaaacttttatc
accatttaattctaatgctgtccaggataatttcacatctattgtaattttgctttcaag
GTGCTTATTGAATACAAGTAATCACTCAGGTGTGGAGGCTTTTATTATTCAAAATATCAA
AAATCAAATTGACATGTCATTAAAG
gtaagaacatagccaaagtgtcaattaccaatttatttcgtagggtatatttattcatat
gtagaatacattaatgtgagttattgctctatctctagtattactattacttaaatatta
ttaaggcatattttttcccctatttctactatgttttaaaaactctgaatttggaaattt
EXON 15  110 bp
gtgttctcaaactggcagggttcgttcctggtgtctggaaagtgaatgaaagtacggaaa
ttaaagttaaaaactgtattttaaatgtgcaattcttcatttttgtagtgtcaaggtatt
agaaaaacacatgaattacatgaattataaagctttctcaatttttcgtttgcttttcag
AGAACACGTAACAACAAATGGTTTACAGGACCACAGTTGATTTCCCTTCTTGATTTGGTA
CTTTTTCTCCCAGAGGGTGCAGAAACAGATTTACTGCAAAACTCAGATAG
gtgaggtgaccattaccaaagttcacatagtaaattcagaataaaatgtgaaacatctgc
ttagggaacctaaagtaataaaatgtcttttcctgtgattttatgatctatggctaattc
attaagttacataaagatttttcatatttaagtgatttgataatgtgtagaaacaaaatt
EXON 16  64 bp
attgtatgatttaaacaaatggaaaacagtgataagttattactactcaaaaagatatta
atggaaatagtttctattggcaaacctaattataaaaatatgaccaaagttttagcttat
tgagattgctgttgactatataaaaccatactgtaagtaacatatatttttaattaacag
GATTATGGCTTCATTAAATTTATTGAGGTATTTGGTTATCAAAGATAATGAAAATGACAA
TCAA
gtaagtgaagtatttgaaaagaaactgtgagtatattcaaaaggcataaggaatgtttca
gatattcagtacctaaagccaatatttaatatcttacccagatataaaggccgggaagag
tgccaacaattattctgaaacctgaagttaattcccaggagcatttaccaccccacatcc
EXON 17  112 bp
atttttcttttaattggtattcacataactagctatagtaataattattaaatagtgaag
tccattgtgaaaagcaagggccatgtttcatttatttttgttttttgagcttttatcgcg
tttaatagtaggcaatcaatcattgttgaactaaataactcattctttcattcttaacag
ACTGGATTATGGACAGAACTTGGAAATATTGAGAATAATTTCTTAAAGCCACTTCATATA
GGACTTAATATGTCAAAAGCACATTATGAAGCAGAAATTAAAAATAGCCAAG
gttggtaatgtgcaattttgttttcaattaggtctaaaaagtagtctaattttggaactg
tcatattcaaatttaagaactttttaaaaatcttgtactttagagaccataacagctaag
ccattttatttatagttaaaattcttagcagatctataagctaatttacctaaaatcggg
EXON 18  83 bp
gaattttgatatttcattctgtttgcttatagcttaagtataccctgagctgttaaacaa
tggacttaataatttatacaaataactgacatgttttaagttagtgaatgaaagtagctt
atacctttgttattgaaatctgagagttaagtgtcacacatgatttttcttctcttacag
AGGCCCAGAAATCTAAAGATCTTTGTTCTATAACTGTAAGTGGAGAAGAGATCCCTAATA
TGCCTCCTGAAATGCAGCTTAAG
gtgatctgaaattttcttttctttcctttttcttctttagaaacggggtcttgctatctt
gcccaagctggagtgcagtggcatgattgtggctcactgcagcttcaactccctgggctc
aagtgatccacccacctcagattcctgattagccaggactgcaggtgcacaccaccatgc
EXON 19  157 bp
actcctggcctctagtaatcctctcagctcagcctcccaaagcacaggaattacaggtgc
aaaccactgtacctggtcttaaatattcctaagctacctccagctgaaatcttttctgtg
ttttgctttgttttgctttaaaggcagcattaataacattactttttcttggcattgcag
GTCCTGCATTCAGCTCTTTTCACATTTGATTTGATTGAAAGTGTTCTAGCTCGAGTGGAA
GAACTCATTGAAATAAAAACAAAGTCTACCTCTGAAGAAAATATTGGGATAAAGTGAAAG
TTCCATTTCCTAAATAAAAACTAATAAAATATAGTAC
tttccattatgattcatttaatacctttataaaaaatttttctgtaaaaatttactgctt
gaaaaataaatgtagcttttctcatttatcaatttctataatgatacactatagaacagg
tttttttggttttaaagttatctaatggtaaataatgcccacatatgtcctaaatactac