Gene FHL3 Variant 1
DNA : 8.60 KbNT_032977
mRNA : 1509 bp NM_004468
CDS : 843 bp NP_004459
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  12 bp
cacttcctcggggaggggttggggccgcgctcccactcgcccacacggtccgtctgcagt
cggcagcctcgccggcagctcgctcggcccccgcttggcccggcccgcaggtaggagccg
ccgagggacgcggcgcccggttcccggccccgcctgcgccgcgcgctccccgctcccgcc
GCCCGCTTCGAG
gtgagcgccccgccgaccccggctcccagccctggcggtccgcccccgcgcccaggccgg
ggagcgaagggacccgcggagggctgaggccagccgcggccccggtcccctgtacccgcc
gggctctggccacgggtgcccggggcacgccgagcccgggacagcgcccgccgggactgg
EXON 2  176 bp
gaaagaaacatgtgggattcctggtttcccagaagcaccccttccccatccccacctact
ctgaactggcatttcctatgccgggtctcttggctgtgttttgaatgcagaggcctcttt
gccaggagccaagccacagcctctctgtgtgaccccagttccaccttgtgctcctaacag
GGTTCTCTCCCCTTGCCACCATGAGCGAGTCATTTGACTGTGCAAAATGCAACGAGTCCC
TGTATGGACGCAAGTACATCCAGACAGACAGCGGCCCCTACTGTGTGCCCTGCTATGACA
ATACCTTTGCCAACACCTGTGCTGAGTGCCAGCAGCTTATCGGGCATGACTCGAGG
gtaaggagagggccaggccaggcaggaggtgggtggtgaccagtggaagggggcaaagga
tgggtccatgaggcctgggtgccagtgcccctgctgtgttccccacaggagctgttctat
gaagaccgccatttccacgagggctgcttccgctgctgccgctgccagcgctcactagcc
EXON 3  175 bp
gtgccctgctatgacaatacctttgccaacacctgtgctgagtgccagcagcttatcggg
catgactcgagggtaaggagagggccaggccaggcaggaggtgggtggtgaccagtggaa
gggggcaaaggatgggtccatgaggcctgggtgccagtgcccctgctgtgttccccacag
GAGCTGTTCTATGAAGACCGCCATTTCCACGAGGGCTGCTTCCGCTGCTGCCGCTGCCAG
CGCTCACTAGCCGATGAACCCTTCACCTGCCAGGACAGTGAGCTGCTCTGCAATGACTGC
TACTGCAGTGCGTTTTCCTCGCAGTGCTCCGCTTGTGGGGAGACTGTCATGCCTG
gtatgtgttcaggggctcatcttgtgtgagaactggcatctgcgtagggtctttgcatgt
gtctgtctgatacatggagacttggtctgtgtaaagacctgcatacacagcatgtttctg
gaaatttagtatatacgggatctgtttgcctggtatactcctgggggctactatgtacag
EXON 4  170 bp
cggtgtctggggagaggttagcatgtgtaatatacatagggcgggggggttcttgctgca
tgtgcacggacaccaccctgctcacgctgagagaggagtggagactcctggggaagttac
agagggtggccctcaggagcatgggacacaacctctaaatgggacccctgttccccacag
GGTCCCGGAAGCTGGAATATGGAGGCCAGACATGGCATGAGCACTGCTTCCTGTGCAGTG
GCTGTGAACAGCCACTGGGCTCCCGTTCTTTTGTGCCCGACAAGGGTGCTCACTACTGCG
TGCCCTGCTATGAGAACAAGTTTGCTCCTCGCTGCGCCCGCTGCAGCAAG
gtgggggctgggccagccaggtgggggtgagtgaggcctgttgtggggtgggaatcccca
ctcatacctactaatggatgctgcccccacagacgctgacacagggtggagtgacatacc
gtgatcagccgtggcatcgagaatgtctggtctgtaccggatgccagacgcccctggcag
EXON 5  187 bp
ccgttcttttgtgcccgacaagggtgctcactactgcgtgccctgctatgagaacaagtt
tgctcctcgctgcgcccgctgcagcaaggtgggggctgggccagccaggtgggggtgagt
gaggcctgttgtggggtgggaatccccactcatacctactaatggatgctgcccccacag
ACGCTGACACAGGGTGGAGTGACATACCGTGATCAGCCGTGGCATCGAGAATGTCTGGTC
TGTACCGGATGCCAGACGCCCCTGGCAGGGCAGCAGTTCACCTCCCGGGATGAAGATCCC
TACTGTGTGGCCTGTTTTGGAGAACTCTTTGCACCTAAGTGCAGCAGCTGCAAGCGCCCC
ATCGTAG
gtgggacaagggtcaaagaacggagtgggtagggtgcaggcaagggagtgggatgtggta
ttgggtgaggttgagggccggaccatccccacatctgcatagctaacttccagcctccct
ccaggactcggtggaggcaagtatgtgtcctttgaagaccgacactggcaccacaactgc
EXON 6  789 bp
ctgttttggagaactctttgcacctaagtgcagcagctgcaagcgccccatcgtaggtgg
gacaagggtcaaagaacggagtgggtagggtgcaggcaagggagtgggatgtggtattgg
gtgaggttgagggccggaccatccccacatctgcatagctaacttccagcctccctccag
GACTCGGTGGAGGCAAGTATGTGTCCTTTGAAGACCGACACTGGCACCACAACTGCTTCT
CCTGCGCCCGCTGCTCTACCTCCCTGGTGGGCCAGGGCTTCGTACCGGATGGAGACCAAG
TGCTCTGCCAGGGCTGTAGCCAGGCAGGGCCCTAAGCCAGGGCTCCTGGACCCAGGCTTT
CCCATACCACGGGCCCAGGACTGTGGCTCCTTTTCTAAACCACCTCTGGGACTCAGCTCC
CCCCGCCAAAAAAAATGGGTCTCCTTCTGGGCTCCAGGATTGTCTCCCCACTCCAGCATC
CCCAAACTGGTACTCCCTGACCCAGGGCCCCAAACCTGGGCTCTTACAGAGCCTCCATGA
GTCAAGCCCCCTCCCCACACCTGGACTCCAGAATTCACCCTCTCCCCTGCAGTCTGGGTT
CCCAGACTGAGTCCTCTCCCCAAATCAGGGCTCTAGACCCGAGCCCTCCAAACCTGGACT
CTGGGACTTAGGCCCCCTTAAATCTAGACTTCTCTTTATAGGTTTCAGGTCTCCTATGGG
TGCCTGGGAAGTCCTTGAAAGTGGACTGTTCTCAGGCTTGACCTGCCCCACCCCATCCCC
GCGGTTGAGGCTGTGGGGGCAGCAGATCAGGAGCCCACTGATAAGGGGCCCTAGGGTACA
GGGTGCTGCCCAGCAGGTCGCCACCGAGTGTCTTCTCATTTTATTTCAGCTCCATTTTGC
CCATAGATGGGCAGAGGGGTGAGATTGGCTCATCCCCCTTCCAGATTCTGCAATAAAGCG
GTGTGAGGA
agcaggggcctccgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgttcagg
gtataatggggaaggaagggtttttgcagactgggaggctcagaatctctgctagacctc
atccttgcagggtggggtggaggggggccgggccatggggtgggaagtctctccccatga