Gene FAM20B Variant 1
DNA : 50.67 KbNT_004487
mRNA : 5984 bp NM_014864
CDS : 1230 bp NP_055679
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  203 bp
gagttaagcggacgggcccggtatggaagaggttaaggggggcagtccggagcgggtccg
gtaggggccgcctactgggcgggggcggggccgcgccgagcgagcgctgggattggccgt
cgggcaggcgctacgctaggacggtaccaacagccgggggcctcggaggcgggggggtgg
GTGTGGGACTGCCGCTCTGCGCGGCGAGAGGTGGCCTGGGAATGGCCGGGCCGGGGGTGG
GCCGGAGCCGCTGTGGCGGCGGCGGCGGCTGGGGGCGGTGAGCGCGGCGTGGGGCTGCCC
CTCCCCGGAGGCGGCGGGGGCGGCCGGGGCCGCGCCGCACCGCACCGCGCGGGCGGCCAT
GGAGCGAGCCTAGGGCCCGACAG
gtgagtggcgcgggggcgggggagggcgcgcgacccccgcccccggcgcggcgggcggga
aaatgcggaccggcacgcgggcggggcacggtacgtagcgcgcgccgggctggggccgcc
tgggggcggggcgcctccctgaggggccgggcaccgggtgccctgagccgtccccgagtg
EXON 2  510 bp
gggccactgctgccatcattaggtccttctccagattagttaattttaaattattgaacc
ttcttgagctcaagaatagaaagcctaaaagggtgagtcatatattagaggcttacaaaa
gattcaggggtggaaggacagaatttttgatcaaattttgctttgtacttgggcttgcag
GAACTGTGGAAGGTGCATCAGTGAAGAAATGGACCAATGTGTATAATCATGGAATCTCCT
TGCTAACCATCACCACCAGCTCTCCTTAATACATGAGCAAGAGTGGGTCAGGGGAGAAGG
AAAAGAGGTCAACATGAAGCTAAAGCAGCGAGTCGTGCTGTTAGCAATTCTCCTTGTCAT
TTTTATCTTCACCAAAGTTTTCCTGATTGACAACTTAGATACATCAGCTGCCAACCGGGA
GGACCAGAGGGCCTTTCACCGAATGATGACTGGCTTGCGGGTGGAGCTGGCACCCAAGCT
GGACCATACCTTGCAGTCTCCCTGGGAGATTGCAGCCCAGTGGGTGGTTCCCCGGGAAGT
GTACCCTGAAGAGACACCAGAGCTGGGGGCAGTCATGCATGCCATGGCCACCAAGAAAAT
CATTAAAGCTGATGTGGGTTATAAAGGGACACAGCTGAAAGCCTTACTGATACTTGAAGG
AGGCCAGAAAGTTGTTTTCAAACCTAAGCG
gtaagttttgatcttggaagctgcatgtgctagttggttgattcatttaacttgggattt
atataagatttattttgtcatcttctcttggaagtctcttcagtaaaataagaggggtag
actagatctctaaagtcttttctagcacttaacatgaatctacctttatagtatcatata
EXON 3  87 bp
ctacctcatcttcattccatctaccggcaattcatgctaatccacagttgtttgcagggt
tgacagagaaggtgactatagcagaatcaggcttgctaatgggtgtattctaccacttgt
gctgtcacctgttactggtgtaatccacgtatacatctgtgcttcccattcactttgcag
GTATAGCCGAGACCATGTGGTGGAAGGGGAACCGTATGCTGGTTATGATAGACACAATGC
AGAGGTAGCAGCCTTTCACTTGGACAG
gtgcgtatgatcacagcagcttatgttcattttgtttgctttcaaaaatctttcttggag
aggactcgtggactccttcagaaggatgcaacactaataaataacttgttatcgatttta
gatagctaattgactagttccattaaacttgtatgagtctcataatttggttggcaccag
EXON 4  110 bp
aataaattatacacaccttcacattaaattcctaaatatatgtacctctaaaaaattagg
tttagctactagctaaaaaccctttacacatttgacatgatgaactgtaatttttaagac
tgttacttaaaaaacatcccctaagatttttctcttctgttcttcaatcttccaaaccag
GATTCTGGGTTTCCACCGAGCCCCCTTGGTAGTTGGCAGATTTGTTAATCTTCGGACAGA
GATCAAACCTGTCGCCACAGAGCAGCTGTTGAGCACCTTCCTAACTGTAG
gtaagaagattgtagaggacatttatataggggaatgattaataagttaaaatggggcat
tgttgagcaagctggctcatgacttttaggaattgaagaactcagtggaatacaaaagca
aatcagacaaccagctctcaggttatttgggaaaatgaatctaaaggagatggcaggaaa
EXON 5  172 bp
tttacaccgtgtgcttttttattacctatacaggaaaataaatgtttgaaatatagtaaa
ctcagggtctttgttttcaccatgcttatttacttagctactctgttctgcattatttgg
gagagaacttggagtcttcgttatttccttaagtgtatttggctcctttctgtcctttag
GAAACAATACTTGTTTTTATGGGAAGTGCTATTACTGCCGAGAAACAGAACCAGCTTGTG
CTGATGGAGACATAATGGAGGGATCTGTCACACTTTGGCTTCCAGATGTGTGGCCTCTGC
AGAAGCACCGTCACCCATGGGGCAGGACTTACCGAGAAGGCAAATTGGCCAG
gtaaatgctcctatgagccattacttaattctcccctgtgcctagccaggtgccaactct
gtaaaggagccagcagttctgtccaagagtgaaaagaactgtggagtcaggggcaaaccg
gtaggtaggaactctgtcttctctttgtgtgtaacagtgccaggtacagtgttgtcactc
EXON 6  192 bp
aattctcccctgtgcctagccaggtgccaactctgtaaaggagccagcagttctgtccaa
gagtgaaaagaactgtggagtcaggggcaaaccggtaggtaggaactctgtcttctcttt
gtgtgtaacagtgccaggtacagtgttgtcactcagtgctgtgatgctgcttgtctccag
GTGGGAGTATGATGAGAGCTACTGTGATGCTGTGAAGAAAACGTCCCCTTATGACTCTGG
CCCGCGCCTCTTGGACATCATTGACACAGCTGTCTTTGATTACCTGATTGGCAATGCTGA
CCGCCATCACTATGAGAGCTTTCAAGATGATGAAGGCGCTAGTATGCTCATCCTTCTTGA
TAATGCCAAAAG
gtgagaccagcaggactgtccttgtcagggaggggtttctgtatatgaaagaagggcatt
ttccagagcatcctggagaatatccagaatgcaattgataggcaacatccttcttttttc
cacttggagtctttgctattggtacctgtccttctctccactctcagggatctcagtact
EXON 7  60 bp
tagggatcctgtgtctaattggtcatgccccgcttgttttcaatttaagtgatttgagct
gctggagcgtgaaattatctaggatcacatttgagtttcatatagaatttgctattgctt
tgatgctaagaagagaacagtacttccacctaattcactaagttttaatttaattttcag
CTTTGGGAACCCCTCGCTGGATGAAAGAAGCATTCTTGCCCCTCTCTATCAGTGTTGCAT

gtaagttatgcacagcaaatacatgtgcctgcattgccttcttttccaggctcaggtaac
agtacatccattttcttggccctcaaactttctgatacctgagcagtgcttttcatactt
ttccaacctagaacctctggacatcctgaaatgggatatcagggaaaggtgaaggcagat
EXON 8  4650 bp
aacaatatcaaaacatagtaatgtggcttactcattatgtaggggtaattctaaagcaaa
aattatttagttaaaggattttacctaattattttttcacttttgtctgcctagcaggct
ttcaactccgtttgataatgagaagttttatgtaccttgttctataactttttctcccag
CATTCGGGTGTCCACCTGGAACAGACTGAACTACCTAAAGAATGGTGTGCTAAAGTCTGC
CTTAAAATCTGCCATGGCCCATGACCCCATCTCCCCAGTGCTCTCTGATCCTCATCTGGA
CGCCGTGGACCAGCGGCTCCTGAGTGTCCTGGCCACCGTGAAGCAGTGCACCGACCAGTT
TGGGATGGACACAGTACTGGTGGAAGACAGGATGCCTCTCTCACACTTGTAATTCTCGAC
ACAAAATAAGTGAAACTTCTTTTTACAAAGATAGAGAAACAGCACAATCAATTCCAAATG
GTATGAGATGGATTGGAAGTGGCCAGCAGCAAGTTCTGGTGACGGGACAGAGTGGCCTTG
GATGTCTTTGGTATTTTCTGTAGTAGAAACTAAAGCAAAGACCACAAGTTTCAGAGCATG
GAGACATTCCTGCTGAATCGCCTTCTCACCTCCTCGGCAATTGCTCATTCTAGGGTTGGG
CATCATAGTTGGTCAGTCTTAATTCCCATGCCAAAGGACAAACAGGTGTGACATTTGGAT
AGATGAATACTGGGATTGGCTCTGGAGCATGTGTTTTGAGTTGAACCTTGCAGTCCTTTC
TCTACGCCCGTGGATTTTGTGGAAACACTTTGCAATCTCTTTGTCTTTTTTTTTTTTACC
AGAACTAGTTACATTGGAATGCTTACTGTCCTACAGAGTGGCAGCAAATAAAACCTTGCA
TTCCATCAAGCCAAAATAGCACACTCTGTTAGAGGAGATACATGTTTAAGATAGAATTGG
AGGGAAGGACAAAAACAGAAAAATGTTTGGGCTTTTAAGCCATTGGGTAGTATTGTTTTG
ATGATCTTAGAGGAGGGAAGAAGAGAGAGAGACCCAATGGTAGAACCAGAATCAGGGAGA
TGACTGAACTACTGAAAAACAGGTTCCCTTGTATTTAGGATCTTAAGGTGTATAAAAAGC
AAACATGACTTTGCACCTAAGTAAATTCTGCATTCTCATAGTTGTGTCCCAATTAACCAA
AAAGTTGTCTCTAGAGAAAATACTATTACAATCTAAGCATGATTCTCTGTGGAGACTAAT
TTTTTCCCCTTTTGCCAAAAGCAGTCCTTCCCAAATTAACAAAGCAAACTGAAATAATAC
CTTGAATAACAGGTTGCCTGTGGTCTCTGTCATCCTCGTTTCTCTTCTGAAATGAATTTC
CACCTCTGCCTTTAAGGCATTTTTGTCACTGAAGCTGCTGTTCCCAAGAGATCGGCAACC
TTTTTGTCCCTTTCTCATAAGAAAGGGACACTCCTACAGGTGAGAGTGTATACCTTACTC
TCTCAGATAAGTGGCTGGACTTATCTTGTGATTTGGGGCCATGGAAGATTGGAAACAAAG
ATTTTAAGCCTTCTTCTTTTTTTCTTTTTTCTTTTTTTTTTGAGACCAAGTCTCACTCTG
TTGCCCAGGCTGGAGTGCAGTGGCACGATCTTGGCTTACTGCAACCTCCGTCTCCCAGGT
TCAAGCGATTCTCTTGCCTCAGCCTCCAGAGTAGCTGGGATTACAGGCGCCCGCCATCGT
GCCCAGCTAATTTTTATATTTTTAGTGGAGACAGGGTTTCGGGTTTCACCATGTTGGCCA
GGTTGATCTTGGACTCCTGACCCCAGGTGATCCACCTGCCTCAGCCTTCCAAAGTGCTGG
GATTACAGGCATGAGCCACCGTGGCCGGCCAAGATTTTAAGCCTTCTGAGCCTTGAAATT
GAGGAGGTTAAAAGGAAGAGCCTTAAGATTTTGATTTATGTCAAATCCTAATTCTATCAT
TCAGTCTTGTTTGGAGTTCTGAACCCATGATGTTGTATTATGCTTCTTTCTCCTCTTAGC
ACTCTCAAATTTCAGGTTTGTAAAACACAGTTTTTGTTTTGTGTTCTGGCAAAGTGATCT
CAACATGTAAGTAGTTGCAGTAAAACACAGGGGCAAAGGAAGACAGGCCTGATGTGCCCA
CTCATCTATGGACTCAGAGCTGTGTGCTTTGCTCCTGCATCTTGTTGAGGTGCTGTTCCA
GCTTTGCATTTCTGTCAAGTAGAGGCGAATATATAAACAGTGTGGTTGAATACATTTAAT
GCCAGCCATTGGAAACTAGTTTTAGGCAACCACTCTCAAAAACAGCTTTAGAATTTATGC
CCAGTTTTCTTGCATTGAAAGATAACTGAGTAATAACCTGTAACTATTTTTAAATGGCAT
GAAATTAGGAAACTTTTGTACATTTTATATACATTTTGAGATGAACAGAACAATGGGCTG
AGTTATAAAAAGCGTGTATTGAATTTAAGAAGACAGACTAGCACAAAACACAGAATTCGT
GTTAACCAAAGGAGGCATTGATTTCAGTTTTAAGGCTACTCAGTGTTGTGTGTCCAGGGA
AATTCACAGCTCAGTATGAGAATACCTTGGTTAGTGCTCACCCACAAGCTTCCAGGAGCC
AGCTGGGAGGAGACAATAGGAAGAGATGTCATCTCTGCTCTCCCTGTAAATGTTAGTTGA
ACTAAGTTATGGATTTGTGGTCTTTCAAATACATGACGCCTTTAGTATGCCACACTGAAA
TGAATAAGAAGTCTTCTGAAACTGGGAACTTCATAACATTGAAGGCAGAAGATTCTGCTA
AGGAAAAAAGCAGGCAGGAAAGAAAATGTCTCATCCTTTCTTGAAAGCATTTGCAGAAAA
TATATCATTTCATTTTATTCCCATCTGTTTTCAAACTCGTGATCTTAAAAGGCATTCTGA
TGATAAATTTAGAATTTTCATCTATAAAATTTAGAACTCTAATCCATAAAGTTAGAATTG
AGCTAATAGAGTGGTATGACATGGCACTAAAAATATAAATTTTTGTTGTAAGTCAGGATT
GGAGTAAGCTGGAAAAGTATGTTTAGGCAAATCTTGGAGAAAACCAACCATAAACTTACA
GCTCTAAAATTCAGAAAGCCCTAAAATTTCAAACACTGTTTGAAAGAAGAGGTGGGGGCC
GGGTGCCGTGGCTCATGCCTGTCATCCCAGCATTTGGGAGGCTGAGGCAGGCAGATCACC
TGAGGCCAGGAGTTCGAGACCAGCCTGGCTGGCTAGCATGGTGAGACCGTCTCTACTAAA
AATGCAAAAATTAACAGGGCACGGTGGCATGCGCCTGTAGTCCCAGCTACTCGGGAGGCT
GAGGCAGGAGAATCACTTGAATCCAGGAGGCGAAGGTTGCAGTGAGCTGAGATTGTGCTG
CTGCACTCCAGCCTGGGAGACAGAGCGAGACTCTGTCTTAAAAAAAAAAAAAGGAGGTGA
ATTTTTTTTTAAGTTTTGTAACACTGTCCTACTTTATTTATTAGAATCTAAGGCTGTTAC
AATCAAGTCGTTGCAGGGTTTGGATCAGCTGTAAGTTAGGTATGCCTACCAAACATCCAA
AGGTAGACGTGGAGACATTTTAATACTACAAAACTAGGAAAATCAGAACTCATGGCCATT
TCCTGCCCTCCTCCAACTTGTTAAAACATGTTTATTCTAAAGTTCGAATGGATAAATTTG
AGTATAAAGGTTTTGTTATAAAACTGTTCTTTAGTGTAAGGCTGCATTGTGGGTTTGGGG
GAAATGTAAATAATTTTCTGTGTAAAACAAATTCATAGGATCTGATTTGCTCAGAGTATT
ATTCAAGAATGTATTAATAAGGCATTGCCCCCTGTTTGCACTCAGGGTTAATATGTCAAA
TGAAATTTAAGAAGGAAATGGAAGAATTCAGGTACATTAATTGCATATTATTTTGGGAAA
GATGAGTCCTATACGTGGCAATTTTTCAATGTCATCTGAAGCCAGCATTATCTTCCAAAG
AAATCGATCTTTTTTTTCTAAAAAAAAAAAATGCTTTTGCCTTCCCTTCCCTTCCCATCC
GCCATATTTCTTCAGCCTTTCTTCTCGATCACCCGTGTATTCTTTGACCAGTAAATGACC
ACACCTCAATGATGGTAAAACAGCATCATCAGTAAGCTATCTTATATGCCTCATCCTGTG
AGTTTGAGCTTCAGGAAACATGAGTAAAAGTATATGTAATGTATATAGTCGTATATGTAT
TCTAGCAAGAAAAACATATTTATTTTGACAAAGGGGAACACTGACTTTCTGAAGGATTCA
GAAAGAACCTTAGTGAAAGGTTCTCAGTCTCTGAGAGTGGACCCTAATTAACATAAAGAC
CATTCATCAGCGAATAACTACTGAGCAACTCTAGTGTGCCAGCACAGGCCAGACATACTA
GTGAGCCAGGCACATCTGGCCTTGGGAAACTCATCCTACAGGGGAAGGCCAGTTTTTTTC
CCTTCAATTCCTCAAGTCTGGGTGGTGACAAGGTAGGGGCTAGGTACTGGACTACCACAG
GTTTTTAGGAACTAAGGTGTTTCTCATAAACACAAAATGTTGGGTGAAACTGGGAACAAC
TACTCAGAAGCTCATTTATTTGCTTAAATGGAAAGTGTGGGAGCCACTACCCTCTCTTTT
GATCTGCCAAGGATTTCCTCTCAGAGCTGTTGCACAGACAGAGATTGTACTTGGTAAGAT
ACCAAACAAGACAGATATGGATCTAAATTTCTAATGTGTTCTATGGGTTTCAATTCTGAA
AAAAGAAAATGAATAAAGATTTTAATAAAT
attgatatctgatcttttcctcttctttcccccttcaggatatttccagtggttcctatt
tcagttcccttcctgttaggggacagaagaagattacatcttttgtgaccacttaaactt
ccacagggatagtttcacagtacctggtggattagacctttaaatttcctcaccagtctt