Gene EFNA3 Variant 1
DNA : 8.67 KbNT_079484
mRNA : 1782 bp NM_004952
CDS : 717 bp NP_004943
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  198 bp
tggtctttcccgagggggcagtacggtccccacctcccacgcgtcgcgcgctcccgaccg
gagcgggacggggcctgtcgggggcgcgccaggggcggggcttcgggggcgcgcccagga
gggcggagggaagggctgggggcgtggcctaaggctgggggccgacggcggcggcagcag
GGAGCTGGGAAGCGGAGAAGCCGGGAGCGCGGGGCTCAGTCGGGGGGCGGCGGCGGCGGC
GGCTCCGGGGATGGCGGCGGCTCCGCTGCTGCTGCTGCTGCTGCTCGTGCCCGTGCCGCT
GCTGCCGCTGCTGGCCCAAGGGCCCGGAGGGGCGCTGGGAAACCGGCATGCGGTGTACTG
GAACAGCTCCAACCAGCA
gtgagtcggggaccctgggagtccgcgcgtcccgtctcagtgagagggggagccggtggg
cccgagaagtcctgggggatcccggggtgggagtcctgggagaccagagctgggggctgg
gaggggacggagagggggacgcactctgtgggcgtctaggaaactcgggggtgtctgaag
EXON 2  314 bp
agacttaggggagcggcggcactagggccccgggggcagagacagggctgagccgcgagg
aagctcggaggaaaagtcggaaggctacgcggaccctggggaggggctgcggagcggtca
gatggaaagcggctttgctctggggtttcttctctctgagccgcttcctcttccccacag
CCTGCGGCGAGAGGGCTACACCGTGCAGGTGAACGTGAACGACTATCTGGATATTTACTG
CCCGCACTACAACAGCTCGGGGGTGGGCCCCGGGGCGGGACCGGGGCCCGGAGGCGGGGC
AGAGCAGTACGTGCTGTACATGGTGAGCCGCAACGGCTACCGCACCTGCAACGCCAGCCA
GGGCTTCAAGCGCTGGGAGTGCAACCGGCCGCACGCCCCGCACAGCCCCATCAAGTTCTC
GGAGAAGTTCCAGCGCTACAGCGCCTTCTCTCTGGGCTACGAGTTCCACGCCGGCCACGA
GTACTACTACATCT
gtgagtgacggcggccgggcgggcgggtctgaacgcgagagtctgagtgacagccggggg
gtggagcccctaggctccggggcggggccggcgcggcgggcgccaggtctcgcggctgag
accagggaggaggcgtgggcacgggacgcctgaggggttcagctcagacgaggtcgtggg
EXON 3  66 bp
gaccaaaggggcgtctagggccgacggcagagctaaagtgacccgtgtccaaagggtagg
ggagctcctgaaggagaccgcccgacggggacagtttggagggggtgagaaatagagccg
tcgagggagggcacaggcacacattgggcgaaagtgactcaggcccggtctcctccccag
CCACGCCCACTCACAACCTGCACTGGAAGTGTCTGAGGATGAAGGTGTTCGTCTGCTGCG
CCTCCA
gtgagtagaataggctccgagccgcgcccccatcctcagctccctgctttggggctcccc
tggcttcctgggggtgggggcggagggcacaggtgaggggggcttgctccccagccgtag
caaggggagggaatcctggccctgactctcccctcctctctccccacccgcaccccaccc
EXON 4  78 bp
tagaataggctccgagccgcgcccccatcctcagctccctgctttggggctcccctggct
tcctgggggtgggggcggagggcacaggtgaggggggcttgctccccagccgtagcaagg
ggagggaatcctggccctgactctcccctcctctctccccacccgcaccccaccccgcag
CATCGCACTCCGGGGAGAAGCCGGTCCCCACTCTCCCCCAGTTCACCATGGGCCCCAATG
TGAAGATCAACGTGCTGG
gtgagtctgcgcagcgccctctggtggccactgctggaaccgcagccccccgccccggtg
cctgctcacctcgcatgccttccctgggggcactgatacttcctaccctgtgggtggtca
cgtccctggctccattgctgctgccgcgtgcccctgccctggcgcgcaacccagccctca
EXON 5  1126 bp
ccactgctggaaccgcagccccccgccccggtgcctgctcacctcgcatgccttccctgg
gggcactgatacttcctaccctgtgggtggtcacgtccctggctccattgctgctgccgc
gtgcccctgccctggcgcgcaacccagccctcaccagtctgtctgttcctctgtccacag
AAGACTTTGAGGGAGAGAACCCTCAGGTGCCCAAGCTTGAGAAGAGCATCAGCGGGACCA
GCCCCAAACGGGAACACCTGCCCCTGGCCGTGGGCATCGCCTTCTTCCTCATGACGTTCT
TGGCCTCCTAGCTCTGCCCCCTCCCCTGGGGGGGGAGAGATGGGGCGGGGCTTGGAAGGA
GCAGGGAGCCTTTGGCCTCTCCAAGGGAAGCCTAGTGGGCCTAGACCCCTCCTCCCATGG
CTAGAAGTGGGGCCTGCACCATACATCTGTGTCCGCCCCCTCTACCCCTTCCCCCCACGT
AGGGCACTGTAGTGGACCAAGCACGGGGACAGCCATGGGTCCCGGGCGGCCTTGTGGCTC
TGGTAATGTTTGGTACCAAACTTGGGGGCCAAAAAGGGCAGTGCTCAGGACTCCCTGGCC
CCTGGTACCTTTCCCTGACTCCTGGTGCCCTCTCCCTTTGTCCCCCCAGAGAGACATATG
CCCCCAGAGAGAGCAAATCGAAGCGTGGGAGGCACCCCCATTGCTCTCCTCCAGGGGCAG
AACATGGGGAGGGGACTAGATGGGCAAGGGGCAGCACTGCCTGCTGCTTCCTTCCCCTGT
TTACAGCAATAAGCACGTCCTCCTCCCCCACTCCCACTTCCAGGATTGTGGTTTGGATTG
AAACCAAGTTTACAAGTAGACACCCCTGGGGGGGCGGGCAGTGGACAAGGATGGCAAGGG
GTGGGCATTGGGGTGCCAGGCAGGCATGTACAGACTCTATATCTCTATATATAATGTACA
GACAGACAGAGTCCCTTCCCTCTTTAACCCCCTGACCTTTCTTGACTTCCCCTTCAGCTT
CAGACCCCTTCCCCACCAGGCTAGGCCCCCCACACCTGGGGGACCCCCTGGCCCCTCTTT
TGTCTTCTGTGAAGACAGGACCTATGCAACGCACAGACACTTTTGGAGACCGTAAAACAA
CAACGCCCCCTCCCTTCCAGCCCTGAGCCGGGAACCATCTCCCAGGACCTTGCCCTGCTC
ACCCTATGTGGTCCCACCTATCCTCCTGGGCCTTTTTCAAGTGCTTTGGCTGTGACTTTC
ATACTCTGCTCTTAGTCTAAAAAAAATAAACTGGAGATAAAAATAA
ctgagtgtgtgtgatttcaaggggccatcacccttctgttacactggttaaacctcacag
ggcacagggcctgagtaggagagggaattctggggccaaagagtcacaacgaggtgttca
aatcttgttctggggctcatcttcattacaaaggcagcgctgcttggaaagagcaagagg