Gene DIO1 Variant 1
DNA : 16.88 KbNT_032977
mRNA : 1843 bp NM_000792
CDS : 750 bp NP_000783
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  343 bp
acctttgtgcacctggttaggaattttctatctcatgacagaaaggcaaacatcttctga
cctgactccttcccctgacccggggttggctgctcctaccctgcaccttcattcagctcc
gcccagtgttgcctggctgcagcctctctgcccatagaactcagagcttactctggcttt
GCCGAGATGGGGCTGCCCCAGCCAGGGCTGTGGCTGAAGAGGCTCTGGGTGCTCTTGGAG
GTGGCTGTGCATGTGGTCGTGGGTAAAGTGCTTCTGATATTGTTTCCAGACAGAGTCAAG
CGGAACATCCTGGCCATGGGCGAGAAGACGGGTATGACCAGGAACCCCCATTTCAGCCAC
GACAACTGGATACCAACCTTTTTCAGCACCCAGTATTTCTGGTTCGTCTTGAAGGTCCGT
TGGCAGCGACTAGAGGACACGACTGAGCTAGGGGGTCTGGCCCCAAACTGCCCGGTGGTC
CGCCTCTCAGGACAGAGGTGCAACATTTGGGAGTTTATGCAAG
gtcaggaggctgccacacacttgaggggtgcttgaaatagcagtggtagagggggatgaa
gagatgggttggaaagtcctgaattctcctactacttttgctgctccttttggaccttct
tgtcctcttcctgcttcctgaaactagaacttcttgtggattgtttctctaagtaacatc
EXON 2  144 bp
cagctccagcccctgctaagtcatgctctctaggtgtcggaccccagtgcctaggaccca
tcctggggtggggggtagggggaaataaaaataacagaattgaacataggagtgaaaatg
gtgcttgtaaaagaaagctgtgtgtagggtctcagtttgtgatggttgttgctgtttcag
GTAATAGGCCACTGGTGCTGAATTTTGGAAGTTGTACCTGACCTTCATTTATGTTCAAAT
TTGACCAGTTCAAGAGGCTTATTGAAGACTTTAGTTCCATAGCAGATTTTCTTGTCATTT
ACATTGAAGAAGCACATGCATCAG
gtacagaaagattctctgcctcttctacctcttcccactgtcttttctctctcccttttc
cccaggccccatctcaaggttgggaggtggaaggaggaagaggaggggagagggaaagag
ccactattcactgagcacccaccactcccaggccctgcactgggctaacctcacagtctg
EXON 3  200 bp
cagttctggatcaatcactaattcctgacgtgaccttgcacattcaaccataatgggaaa
ccaggccaaatcattgccaagggctcctctgagaacctcagttaaaagtgaggggctatt
tagtctgcaggaagtgtgtgctgtgtcaatgggactcggtgcctggcctttctcttgtag
ATGGCTGGGCTTTTAAGAACAACATGGACATCAGAAATCACCAGAACCTTCAGGATCGCC
TGCAGGCAGCCCATCTACTGCTGGCCAGGAGCCCCCAGTGCCCTGTGGTGGTGGACACCA
TGCAGAACCAGAGCAGCCAGCTCTACGCAGCACTGCCTGAGAGGCTCTACATAATCCAGG
AGGGCAGGATCCTCTACAAG
gtggtgacctggggacagggggcccagggagggcaaaggggcccagggagggcaagggca
aagagaaggctttgcatcaagcagaactggattcaaatcaccacccagccacttaccagc
catgtgaccatgggcgagtgctttcacttcttggagttccttcaatttcctcttctgcaa
EXON 4  1156 bp
tgccactgtacacactttctcaaccacctcacggttgcatctgccattgaattagccatg
ctgatggctcctacacagacatcatttgaccacctcttgcaactaacctccagacctaca
tgttccttacaacttggaaatccttacaagttgggaatgcctgattcgtttctcttgcag
GGTAAATCTGGCCCTTGGAACTACAACCCAGAGGAAGTTCGTGCTGTTCTGGAAAAGCTC
CACAGTTAATCTGGACAGATACCTCAATTCTAGGTGACCAACGGGAGGGCTTCTCAAGGC
TTAGCTCTCCCTGAGACCCAGCTGGCTTTTACCCTTGACCTGTGTCCCTAGCTGAATCAC
TAGCTCAGATTTTTCTGATCTAAGCAAACAACTCCCAGCTGAGGAATGCAGGCCACAGCA
CCCAATCAAGACAAATTGTTATTATCAGAAAATGAAGCAACACTTGAGCTGTTCAGGCCA
GTTCCCTGTTGAAGAAACAGTTCCCTGTTGAAGAAAGTAGAGCCTGACACTGCTCCCACT
TTGGAGACCACATTCCCTGCACACGGTCTTTGAGAGAGCAGTTGCACTCTACAGGCACAC
TTCTGAGGTACGGTATCTCTCTCCAGCCACTCTGATACCAAGTAATTCAAGCTGGCATTC
CTTCTATTAGGGAAATTCATTTTACCCAATTTGCATTTATGGAATTGATCATTTAAGACA
CTAAATTAGTTTTTAGAACCAATTATGGGAAGAATTCCAGTTGTTAGGAAGAGATGAGGA
GTTGGAAGAGGAGGGATTAGAAACAGGAGGAGGCAGTCATCCTCTCCTTGCCAAAAGATT
TAAACCTGTCCACATTGGTGGTGATGATGGGTGAGTTTCCATGGTAACACATCCCTAATT
TTACCAGGGAAGAGGAGAGTACTCACTTTACCATCTTTGAATATATTTCATAGAAATCTA
GCTCTCTGTACCCTGAAATCTTCCACTAGCCTCACTTTTCAACAGAGTCATCTAGAAGGG
AGGGTTGGCTTCCCAAAAGCATAACCTTGACCAAACCAAACAATAGGCACCAGCAATGCT
GTCATTCAGTTATGCAGAAGCTCATTTGTGAAATTCTGTTTCTCTGATTTCTTCGCAAGT
CTCTTAATGGTCATTTGTGTTAGATTACATCAAACTGATGGATAGCCATTGGTATTCATC
TATTTTAACTCTGTGTCTTTACATATTTGTTTATGATGGCCACAGCCTAAAGTACACACG
GCTGTGACTTGATTCAAAAGAAAATGTTATAAGATGCAGTAAACTAATAACAGAATTATT
AAAATATATCAGGCTA
ttttggatggcttccgtgtgatctttacattttcttttccaatttgtatctgattaccca
gtgtaatctgaccagcaaaaataccatacgctgaaagggcctcattttgggggaagaaca
ttcaggccctatgttacatgttaaatgtggttttgtcttatgaactcctgctggagtgaa