Gene CTBS Variant 1
DNA : 19.88 KbNT_026943
mRNA : 1618 bp NM_004388
CDS : 1158 bp NP_004379
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  177 bp
cacccacctgtagcgcccggggacgctcgaagcccgacctcccacgcccgccccggagcc
ccgcccctcccgcccctccccgcccttcccgactctccccgccccttcctgccccgacgc
gcagcaggccccgcccacccaggcggtaggaacccactccggcccgctagacctgctgct
ATGTCCCGGCCGCAGCTTCGACGCTGGCGCCTCGTCTCTAGCCCGCCGAGCGGCGTCCCG
GGTCTAGCGCTGCTGGCGCTGCTGGCGCTGCTGGCGCTGCGGCTCGCGGCCGGGACCGAC
TGCCCATGCCCGGAGCCTGAGCTCTGCCGCCCGATTCGCCACCATCCAGATTTCGAG
gtcagcgccttcctctgctcctctaggtctgggcttcagggcacgaagagaagttagggt
agaacggagccctaaggagaggtgccgtgggcgccgaaaccagctttgaccactcgatga
gggccttcctgtttacggatccttcaatttatagatgaggaagctcgggctcagagaagt
EXON 2  139 bp
ctttcccagcctggctaattacccctgccaccaattatcttgggacccctatgtcttatg
cacttgtactctcactgccaccatagtgtttggtgtatggtgatgtttgatgaacggtat
tttggacggtcagcataatattcttggtttaaatgatggtgctcatctttgttctggcag
GTCTTTGTGTTTGATGTTGGACAGAAAACTTGGAAATCTTATGATTGGTCACAGATTACA
ACTGTGGCAACATTTGGAAAATATGACTCAGAACTTATGTGCTACGCTCATTCAAAAGGA
GCCAGAGTAGTACTTAAAG
gtatgttgtttccagatctatgtgtgcagcaattgggaaatttatctgtatcacttgcta
tagtcccgactttccaaaaaagtccttttatgtttatctgtttttgttaggatcctataa
ttaatcttagatactgtgtaattcatttcacaaacacagatctttttaaaagaattaaac
EXON 3  209 bp
taacttcagaacaattttactaatgatttataatggttattttggagattcatgagtaat
ggctttctgttactttggtatattctttctccattggaaaacttcagttaagggcttagt
cttccaaaataatgaaatgtttttgcatacatgttcaaaagatatatacttcttccacag
GAGATGTATCCTTAAAGGATATCATTGATCCTGCTTTCAGAGCATCCTGGATAGCTCAAA
AACTTAATTTGGCCAAAACACAATATATGGATGGAATTAATATAGATATAGAGCAAGAAG
TTAATTGTTTATCACCTGAATATGATGCATTAACTGCTTTAGTCAAAGAAACTACAGACT
CTTTCCATCGTGAAATTGAGGGATCACAG
gtaaaaactcatttattttttggaaacctcatattttccatatcagaatatactcatgag
ggtataactaatataatctttgttttatagtaatgcaatgggaaagagtttcagcactta
tttcctaaaaaatttttctggagcctttggtgttcttatttaaggaattttaaagcccta
EXON 4  172 bp
agcaaaaaatatttcttagaatggttcaagttctatgtgtgtcaaaccctacattcatat
actgtaagcagttccttttccttgtgtagtataaggtaaaaaatatatataattttaaaa
atctgacgtaatatgcacacgtgatcatattacataaaatagtaagatttttttccacag
GTAACCTTTGATGTAGCTTGGTCTCCAAAGAACATAGACAGAAGATGCTATAATTATACT
GGAATCGCAGATGCTTGTGACTTCCTCTTTGTGATGTCTTATGATGAACAAAGTCAGATC
TGGTCAGAATGTATTGCAGCAGCCAATGCTCCCTATAATCAGACATTAACTG
gtaagactctaaacatggtcatttattaataatattaataatattctataaattaaaata
ttaagatgtttttagtatttctaagttatatgtatacgtttttcaattgtaaggcttgct
tcaaacatgtaaaaatcacttaattgaaagctttaaagtttacaaaaagttttaaagttt
EXON 5  98 bp
agaaagcaagatatagaatttatggttcttaagggatgttttataacatattaaacaata
ttagtgttttttataaatgtacttgtttttacaaacagattctgaacggttgcatagctt
gtatgaacacattgacatatgaagagaaacaaatatgctttttctctcctgcttgactag
GATATAATGACTACATCAAGATGAGCATTAATCCTAAGAAACTTGTAATGGGTGTTCCTT
GGTATGGTTATGATTATACCTGCCTGAATCTGTCTGAG
gtaggaacagtcatttgttacataatttttattatctattatattttttagagtctctct
gttttcattagaaatatataaactttagaatctctgaaatatagtttgagataaaaatta
tttatttttacttctatgaaagcttatgattatcatacattttcatttaataatgaaatt
EXON 6  162 bp
tgaaagcttatgattatcatacattttcatttaataatgaaatttattttaacctttttt
ctgtatagtcaggttttctatggtatatgttttatttctaaataatttatatatttttgg
tttggcttttaagaattgcataattgataatatataacatgagcacttttgcatttctag
GATCATGTTTGTACCATTGCAAAAGTCCCTTTCCGGGGGGCTCCTTGTAGTGACGCTGCA
GGACGTCAGGTGCCCTACAAAACGATCATGAAGCAAATAAATAGTTCTATTTCTGGAAAC
CTATGGGATAAAGATCAGCGGGCTCCTTATTATAACTATAAA
gtaagacttttcgtaagttatgagcatttattctattagtttttgtaattattttcataa
ttagatgtttgatatcaagaatttctatcagttttcttttagggcataacatgcagactg
ctatttacatgagtaaacttgtctttgaatctgtaatcaggaactttagttccctggcga
EXON 7  661 bp
tatagaataggaaagtgttatgccctaaaatttttatttcattgtatcctttttgaataa
ttggatttaggaaacttttttccctcttactgtactgtatacttcttttatttttccctt
tcctgtggtgctgaattgtactaaatactttaaaatctccattttaatttatttatatag
GATCCTGCTGGCCACTTTCATCAAGTATGGTATGATAACCCTCAGAGTATTTCTTTAAAG
GCAACATATATACAAAACTATCGCTTACGGGGCATTGGCATGTGGAATGCAAACTGTCTT
GACTACTCTGGAGATGCTGTAGCCAAACAGCAAACTGAAGAAATGTGGGAAGTCTTAAAG
CCAAAGCTGTTACAGAGATGAACATCTTTTGTCAAACCATTAAGAGTTAGAAAGATGATC
TGTATCAACAGATCTAGTTTCTTGCATTTTTATTATGTTGCTATATACTTTTGTTATCCG
TATACTAAAAAAAAAGAATAAATAAATGTTTTGATTGTTTGAATTTGAAAAATACACACG
AATGTCCTCAGTATCCAGGAACATAAAGGCAAGAAGCAAGTCAACTTACCTATTAAATAT
TCCTCTATTAGATGTTTCAACACTATAATTTAATTGGGAAAAATTGCTTTCAGAATTTTA
TTATGCCATATTTCCCTTCATTATAGTAAAATATATGCTCACGAATCAATGCTGATTTTT
AAAATATGTATAATCTGAAGTGGAAATTGTTTGCTTAGAGTTTTTAAAAACCTAGTCTTT
GAAAAGCAGTTTGTGCTATACTTTTCCCCCAACCCTCCAATAAATCTTAAATTTAAAACC
T
acaatgtagtgtctcccctttaggttcatcaaactgatgaaaataatttttctgcttcct
gactccatatagtatttatgttctctgaggtacttgaactaaatctttggacagtgagtg
agaattaaaaagaatccagaagattaaatgtattcacaaaatagaagaatgtaacagtaa