Gene CRABP2 Variant 1
DNA : 5.97 KbNT_079484
mRNA : 969 bp NM_001878
CDS : 417 bp NP_001869
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  207 bp
aaggctatctcggtccccagagaagcctggacccacacgcgggctagatccagaggttgg
tggcgggggcgcagggccccccaggtgggggggggcggagcgggaggcggggccacttca
atcctgggcaggggcggttccgtacagggtataaaagctgtccgcgcgggagcccaggcc
AGCTTTGGGGTTGTCCCTGGACTTGTCTTGGTTCCAGAACCTGACGACCCGGCGACGGCG
ACGTCTCTTTTGACTAAAAGACAGTGTCCAGTGCTCCAGCCTAGGAGTCTACGGGGACCG
CCTCCCGCGCCGCCACCATGCCCAACTTCTCTGGCAACTGGAAAATCATCCGATCGGAAA
ACTTCGAGGAATTGCTCAAAGTGCTGG
gtaaggaaatgttcgagggcccaggtggggcaagggggggctctggagtcctcgaagttg
gggatgagaaagacagcgggaccacaatcagggcgtgagacactgggtgcctgcatcccc
gaaaaacgtgccaggcgtccgggtcccggggctctgggcacgacgcctaaatcccgcttt
EXON 2  179 bp
caccgcctaccgtctccttcaaggcactttcttagacacccaggcaccaggcagatgcac
cccccaacacacccaccccaagcaagtcacaaatcagcctgctccaactgtcttatgggg
agggtgtgagagaggtgcccaaaggcccctaaaaggtgagcctctcctctctccccacag
GGGTGAATGTGATGCTGAGGAAGATTGCTGTGGCTGCAGCGTCCAAGCCAGCAGTGGAGA
TCAAACAGGAGGGAGACACTTTCTACATCAAAACCTCCACCACCGTGCGCACCACAGAGA
TTAACTTCAAGGTTGGGGAGGAGTTTGAGGAGCAGACTGTGGATGGGAGGCCCTGTAAG
gtgagtgccagaaggggctccagggtcatggcgtcattgccctgcctctcaacctgccat
tttccaggctagcagttaactcctagcttctctctgtcccagtagggaaaatccctaggt
ggtggtgggggctagaaaggggctctctcccttatccctctcactgcattgcccctgcta
EXON 3  117 bp
attgccctgcctctcaacctgccattttccaggctagcagttaactcctagcttctctct
gtcccagtagggaaaatccctaggtggtggtgggggctagaaaggggctctctcccttat
ccctctcactgcattgcccctgctatgggcccagctcacttggccacctgtctcttgcag
AGCCTGGTGAAATGGGAGAGTGAGAATAAAATGGTCTGTGAGCAGAAGCTCCTGAAGGGA
GAGGGCCCCAAGACCTCGTGGACCAGAGAACTGACCAACGATGGGGAACTGATCCTG
gtaagtcctgcctcctccccactaatagcaaacccagtgctaccttccaagattctctgg
gagaccccagggtgcaggagactcaagaacaaccatggctggactccgcaccctgctgat
gggactgcttgaacagaactaaggtgtccctatcccatacagtgccctgtgtgaattaga
EXON 4  466 bp
attgctatcctccctccattgatgcctgggcattctgggaccagctcctgcctgttggtc
ttgagccaagaagcaggtttggacctggaggccaagcagagtacctccattcaaccctcc
tctccaaagccacaggaccccaggggcctctcaggctaacaactacttctgtccttccag
ACCATGACGGCGGATGACGTTGTGTGCACCAGGGTCTACGTCCGAGAGTGAGTGGCCACA
GGTAGAACCGCGGCCGAAGCCCACCACTGGCCATGCTCACCGCCCTGCTTCACTGCCCCC
TCCGTCCCACCCCCTCCTTCTAGGATAGCGCTCCCCTTACCCCAGTCACTTCTGGGGGTC
ACTGGGATGCCTCTTGCAGGGTCTTGCTTTCTTTGACCTCTTCTCTCCTCCCCTACACCA
ACAAAGAGGAATGGCTGCAAGAGCCCAGATCACCCATTCCGGGTTCACTCCCCGCCTCCC
CAAGTCAGCAGTCCTAGCCCCAAACCAGCCCAGAGCAGGGTCTCTCTAAAGGGGACTTGA
GGGCCTGAGCAGGAAAGACTGGCCCTCTAGCTTCTACCCTTTGTCCCTGTAGCCTATACA
GTTTAGAATATTTATTTGTTAATTTTATTAAAATGCTTTAAAAAAA
taaaacctgtctctggctcattgggcaggtagataagtcacctgagttcaaccttgcctc
tgaaatgtagtatgggaaagacttgtgtttctgcagcatggaactgagttatacaacagg
agaggacagtccttccagtcaccgttctaaccaccaccccttcgtttgctgctgaatcca