Gene COL8A2 Variant 1
DNA : 5.00 KbNT_079482
mRNA : 4443 bp NM_005202
CDS : 2112 bp NP_005193
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  200 bp
ccccgcgactttgaaaattgcttgtgaataatatctaaattcggaattgcttctcagcct
tttgactgaaatctccagtgtaatctctaaattctgatcttttggtgaccccgggcctag
tgccaaaccacccagggctggcttgatgactttctctgttcttctttgcagcacgtccac
GGACGCCATGCTGGGGACTCTGACACCCCTGTCTTCGCTGCTGCTGCTGCTACTGGTGCT
GGTGCTGGGGTGTGGGCCGCGGGCGTCCTCTGGTGGCGGGGCCGGTGGGGCGGCGGGCTA
TGCCCCAGTGAAGTACATCCAGCCCATGCAGAAAGGACCTGTGGGACCGCCCTTCCGTGA
GGGCAAAGGCCAGTACCTGG
gtgagagcctcctcaccccacagtgcctcaaatcgctcccagcccccaaatcccctgcct
ccctgagagccatcagatcctcaggcgccctccacagctcctcattccccaccaattttc
ctaccttcagtgtttttcctaataccccagagggcctggaaacggtgcagttagctggca
EXON 2  4243 bp
cctgttgcccccaagatgtcccctgggccacccccaaaccccatcttccatgagagcagg
aaggggcagccccattcttcctctcccgtgtacctcatactggaatgggggaatgggtag
atggggtcccctgtccccacagttcaggcccctgactgcccctttctctttctttctcag
AAATGCCTCTACCGCTGCTGCCGATGGACCTGAAGGGAGAGCCCGGCCCCCCTGGGAAGC
CCGGGCCTCGGGGTCCCCCTGGCCCCCCTGGCTTCCCAGGAAAACCAGGCATGGGAAAGC
CAGGACTCCATGGGCAGCCTGGCCCTGCTGGGCCCCCTGGCTTCTCCCGGATGGGCAAGG
CTGGTCCCCCAGGGCTCCCTGGCAAGGTCGGGCCACCAGGGCAGCCGGGGCTTCGGGGGG
AGCCAGGAATACGAGGGGACCAGGGCCTCCGGGGACCCCCAGGACCCCCTGGCCTCCCGG
GCCCCTCAGGCATTACTATCCCTGGAAAACCAGGTGCCCAAGGGGTGCCAGGGCCCCCAG
GATTCCAGGGGGAACCAGGGCCCCAGGGGGAGCCTGGGCCCCCAGGTGATCGAGGCCTCA
AGGGGGATAATGGAGTGGGCCAGCCCGGGCTGCCTGGGGCCCCAGGGCAGGGGGGTGCCC
CCGGCCCCCCCGGCCTCCCTGGTCCAGCTGGCTTAGGCAAACCTGGTTTGGATGGGCTTC
CTGGGGCCCCAGGAGACAAGGGTGAGTCTGGGCCTCCTGGAGTTCCAGGCCCCAGGGGGG
AGCCAGGAGCTGTGGGCCCAAAAGGACCTCCTGGAGTAGACGGTGTGGGAGTCCCAGGGG
CAGCAGGGTTGCCAGGACCACAGGGCCCATCAGGGGCCAAAGGGGAGCCAGGGACCCGGG
GCCCCCCTGGGCTGATAGGCCCCACTGGCTATGGGATGCCAGGACTGCCAGGCCCCAAGG
GGGACAGGGGCCCAGCTGGGGTCCCAGGACTCTTGGGGGACAGGGGTGAGCCAGGGGAGG
ATGGGGAGCCAGGGGAGCAGGGCCCACAGGGTCTTGGGGGTCCCCCTGGACTTCCTGGGT
CTGCAGGGCTTCCTGGCAGACGTGGGCCCCCTGGGCCTAAGGGTGAGGCAGGGCCTGGAG
GACCCCCAGGAGTGCCTGGCATTCGAGGTGACCAGGGGCCTAGTGGCCTGGCTGGGAAAC
CAGGGGTCCCAGGTGAGAGGGGACTTCCTGGGGCCCATGGACCCCCTGGACCAACTGGGC
CCAAGGGTGAGCCGGGTTTCACGGGTCGCCCTGGAGGACCAGGGGTGGCAGGAGCCCTGG
GGCAGAAAGGTGACTTGGGGCTCCCTGGGCAGCCTGGCCTGAGGGGTCCCTCAGGAATCC
CAGGACTCCAGGGTCCAGCTGGCCCTATTGGGCCCCAAGGCCTGCCGGGCCTGAAGGGGG
AACCAGGCCTGCCAGGGCCCCCTGGAGAGGGGAGAGCAGGGGAACCTGGCACGGCTGGGC
CCACGGGGCCCCCAGGGGTCCCTGGCTCCCCTGGAATCACGGGCCCTCCGGGGCCTCCCG
GGCCCCCGGGACCCCCTGGTGCCCCTGGGGCCTTCGATGAGACTGGCATCGCAGGCTTGC
ACCTGCCCAACGGCGGTGTGGAGGGTGCCGTGCTGGGCAAGGGGGGCAAGCCACAGTTTG
GGCTGGGCGAGCTGTCTGCCCATGCCACACCGGCCTTCACTGCGGTGCTCACCTCGCCCT
TCCCCGCCTCGGGCATGCCCGTGAAATTTGACCGGACTCTCTACAATGGCCACAGCGGCT
ACAACCCAGCCACTGGCATCTTCACCTGCCCTGTGGGCGGCGTCTACTACTTTGCTTACC
ATGTGCACGTCAAGGGCACCAACGTGTGGGTGGCCCTGTACAAGAACAACGTGCCGGCCA
CCTATACCTACGATGAGTACAAGAAGGGCTACCTGGACCAGGCATCTGGTGGGGCCGTGC
TCCAGCTGCGGCCCAACGACCAGGTCTGGGTGCAGATGCCGTCGGACCAGGCCAACGGCC
TCTACTCCACGGAGTACATCCACTCCTCCTTTTCAGGATTCTTGCTCTGCCCCACATAAC
CCGCGGGGGGGGTCCTGCTGCCCTGGCCTCCTCCCCTTTAGTGGTAGAGCGACCTTTTCA
ATTACAAAGAACCTCCTGGAAAAAAAAACAAAAGCTGAACAGAGGCGGCCGTGGCCTTGG
CCCGAGGAGACTAACTTGCTTTCTCCCTGCATGCAGGCTGAGATTGTTTCTGGAAGGGGC
TGGCCTGAGTTTCTTTCCCCCAAATGTCTGTGCAGTGTCAGGGCTGCACCCCATAGGCCC
TGAGGCACACAGCCCAGCCCCTTGTGAGTCCTGGCCTCTGCTGGGCCCTGAAGGAGCTGA
GAGGGAGCTCAACTCCCCACCCCGCCACGTGGGGAGACAGCCCTTCCCACTGGCTCCCTG
ATGGCACCTGCTGGAGGAAAGGGGCACGGCCTCCCTCACAGCCCTTGGCTGGGGCTCCTC
CAGCTCCCCCTGGGACCTCCAGCATATGACAGTGGACTAAGGACTGTGGGGTTTTCCTCC
AAGGGGAAGGGAGAAGAGGGGACCATCGAGGTGGCGAGTGTGGACACCCTGCCAGGACTG
CAGCCCCCATGGTGATGCTGTGGCATCAGACATGTCCGTGGTGGGCACAGTGCCTGTTGC
CCTGGGAAAGGGCAACCTCCCTTTCACTGCTCCAGTGGCAGCCATGGGGAAGGCAGTTTG
TGAGGGCTTGGGGCACAGACCTGGGGCAGGAGGCAGCTCTTCACGTTCATCCCTGTCTCT
CCCGGGCTGCCCCCGCCAGCTCTGGCTGTTTAGCTTGAGGGCAGCACAGAGGCCCCTGGG
ACACCTACAGGCCAGAAAGATCAACCTCTGTGAAGTGTCTAGAAGTATCTAGTGCAGATG
GTGGCGGAGGCAGAATCGACCATCAGCAAACATGAGCACTCTTCCCTTTCTCCCCTTCCA
CCTGCTGCGGGCTGGGCTGGTTTTCTCAATACAAAATTGTAAGAGGATCCTTGTCACCCC
AGCCAGGTATCCCCAAGGCAGAGCACCTCTCGTTTGGCCCTCTGAACAAGGTGCACGCGA
GCTGGGGGATGAAGACGGCTCCCACTTCCTTTTCCTTAATAAGAACCATATGGTGGGTGT
ATGTGTGTACAAGAGGGGTTCATCTGTGGGGGCTTCCTCTCCTTCCACCCTCTGGTTCCA
ATTTCCTGTTCTAAGCAGGACTAGGGCCCAGGAGGCTAAGGCTGGGAGAGAAAGGGTGCC
AACAGGTCCCTTGGGAATGAGTTGGCTCTGGACGTTTCTGCCCTGTTCCCCGATCAGAGC
TCCTCTGCAGGAAACAGGCAGGATGCCCCTCCCAACCCCTCAGTCCCTACGTCAAGCGGA
GTGGATAAGGCTGAGATGAGTGCTGGGAGTGGTGGACATTCCTGCTCGTGCAAAGATGGC
CACTTTCCCCGCAGCTGCAGGGCCTCGCGCTCGGCCCTCGCCAGGCCAGCCCCACTCCTT
GTACCAAGTGTGAACTGGGGTCATTCGGTCTGTGATCTCGTTGCACTGCTCCAAGTCTGG
CTGTGTCCAGGCGGTCCATGTTGAAAATGGAGGATGGCTGCTGACTTCTGACTGGCTGAG
CAGTGGGTTCCTTCAGGTTCCTTGCCAACCCTCCTCCCCTGCCCACAACTTCTCCAAACA
AAGCAGGCTGTTTGCTCACTTCTTCAAAAGGAGGAATGATAACCCAAATCTGCCCAAGTG
ACACTTGAGAAGGTTTTGGCTGGGGTTCCTGGTGGATTTCTTACTACCTAACGCCCAAGA
AAACCAACTAAGGACTCTCAAACCATACCTGGTGGGGGTTCTTCGCTCAACCTCTTCTTC
CCTAGGTCAAAGCCACTATCATCTGATGTGTTAGGGATGGGTTCTGATTGGCAGAAATTA
ATCAGCTCCCAATGGGAGCCCACGGAACTAAGTAGGGTCCCAAGAAAAAAAACGGGAGCT
ATTTCACAGAGCTGAGCTTCTGCCAAATTTCATTCCTCAAACCTTTCAGGAGGGGTGGTT
GGCGTTTCTAAAATGTTTATGGGATTTGAGTTGCAGGTGTCCACTTAACTGACTAGCTTT
GATAAACAATGTCAGATTTTAACTATGAAAACGACATTACCTTGTGCATTTTTATATTGA
TTCCTATTTTTTTTTTAAGATTAAAGTTTAAATGTTTTCCACTAGTCATTTCACTTCTAA
CTTGGTATAGGAAGCTTAGCTCTCTACATACCTATCATGTGCCCTGTATCACAGAAGATT
CAGGAAAAATGCACTTGGGAATCAAAGAAAATGGAACTTCTTTTTGAAAAGACAAGCAAC
CATGTTAACTGTATTGACACATCCTCAATAAAACCTGTTGTAT
aaaacagcactgtgctgaaactgatactgacacagaggtatctcaagcctctgggttctg
taaggtgtccaggaagctctctggggcttgtgtgcctgctcttaaggatcatgcactcct
caccagctccctaacctggatttctgtcaccaccacatcacaaatgcctgatgctcgtaa