Gene CEPT1 Variant 1
DNA : 44.84 KbNT_019273
mRNA : 2164 bp NM_006090
CDS : 1251 bp NP_006081
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  48 bp
tatgctaaaaggagacagggctgggccacggggcgcgctcccgagcagaccggccggccc
cggggcgcgctcacggcaccgaggagcgcgcctgcggcgctgctcgttcaaaccttgttc
ccctttacggcaatcgcgaaagtgtcgtgaacgtgctgccgccgatcagtcacccagtcg
GCTGGAGTCGGAGGCGATATTTCTAGGGGTGTACTTGTTGGGGTCAGG
gtaaggctgcggagcgcggtcaccggacgtgaaggatttgaagggcgttgtaggggccag
tggagagaggactggatgctctggggcgggtcattaggatatagctgtgtatggactcgc
gcgaggcgaacgccgtccttcttcctggcgcagggtggcctcgcgcgcggggttgtgggg
EXON 2  412 bp
ttatacactttcaataagaactagaaccaaaatcaggtccctccttttctggtcctgttt
gatacttactactttattgacaatttgattttttgtttcctaatttgttaatattggcat
aagatgtaaatagtggccaacaagtgtattttttaatttttattttattttattttttag
GTAAGCACCAGCCACAAAAACCTACAAAAGAAGGGAAATTACTGTCTTTAAATATTAAAA
AAAAACAAGATCCATGAGTGGGCATCGATCAACAAGGAAAAGATGTGGAGATTCTCACCC
GGAGTCCCCAGTGGGCTTCGGGCATATGAGTACTACAGGATGTGTATTAAATAAATTGTT
TCAGTTACCAACACCACCATTGTCAAGACACCAACTAAAGCGGCTAGAAGAACACAGATA
TCAAAGTGCTGGACGGTCCCTGCTTGAGCCCTTAATGCAAGGGTATTGGGAATGGCTCGT
TAGAAGAGTTCCCTCCTGGATTGCCCCAAATCTCATCACCATCATTGGACTGTCAATAAA
CATCTGTACAACTATTTTATTAGTCTTCTACTGCCCTACAGCTACAGAGCAG
gtaagagtttcttaacagatctcaacatttgctatataccaaaaacgttgtaattgggat
cgtggggtcattttaactaaagataaagtaatctgacagctgtcaactattttaaaatat
cacacacactgtgataaagcttgtaagtacagcctacacacttgcttattggaaaccaga
EXON 3  148 bp
ccaccgcgcccggcattcttttacaattctaattgtttcagtgagttcttcattatgtag
cacttggatcttctctcccatagcttccaactagctttccaacctgcaggtaaaaatatg
ttagtcaaacatggtaactgtgtgtctgaatactcttgcctttcttattttatttcacag
GCACCTCTGTGGGCATATATTGCTTGTGCCTGTGGCCTTTTCATTTACCAGTCTTTGGAT
GCTATTGATGGGAAACAGGCAAGAAGAACCAATAGTAGTTCTCCTCTGGGAGAACTTTTT
GATCATGGCTGTGATTCACTATCAACAG
gtattgttgatttttttaatgttattgattattaacaatggttaaaccagtgtgctaagc
agtgttagaatacatgtttagtcatgagaataagtaattttgtattaaattttagtattt
ctcaaaagactatgaacctagttaatatttgttcattattggtagtgttaggaaatttag
EXON 4  142 bp
gattgaaattatggggtaagagattatgtaacagattatatcctacttttctgttacaat
agataactgagagaagattatgcatttacagcatatctttttgtctcatctaaaatcatt
tccagctcagttgtttgctattcatattatttggttttcatcgtgatctttcttctgcag
TTTTTGTGGTTCTTGGAACTTGTATTGCAGTGCAGCTGGGGACAAACCCTGATTGGATGT
TTTTTTGTTGTTTTGCGGGGACATTTATGTTCTATTGTGCGCACTGGCAAACGTATGTTT
CTGGAACATTGCGATTTGGAAT
gtaagtaatacttaatggtaatttttgttttctctttcacatatggagaatgttgcctta
taagtatttgagtattagaaattgatcaaatcactaagttagtttaataaattaaaaaat
ttatgcttcattattatagctatttcctaatagtctctgcatatgtccctctattatact
EXON 5  85 bp
tttggattttatatgattttgctcataacaaatttttgatgcctccttttcccctttcct
caatatttgagattttttttttctattgtgcatgatagaggaatgctgctaagcttgcaa
gtaattaacttgaaattgttgtgactaattctgctcttttggctttttgtacctaatcag
AATTGATGTGACTGAAGTGCAAATCTTCATAATAATCATGCATTTGCTGGCAGTGATTGG
AGGACCACCTTTTTGGCAATCTATG
gtaactttgttcacattgtgtatcccatgtaatgcatgttgtcttttgcttgtgttttct
aatatgggataatccagttaaagggtaatgtgtgaaattcttttatttttttccaaacag
tagaacacaacttctctttagaggatggtgaattttactacttgaagttatgtagaacgt
EXON 6  132 bp
tcaactcttgagacttgctatattgcttataatgaagaggaaaaggacactttcattact
ttacgtatttatgtaattggagggaatggaaagtttttgggaatatgaatcaaatattag
actgttttcttattttagtttgtatatgttttaattgttttctctctctacccattaaag
ATTCCAGTGCTGAATATTCAAATGAAAATTTTTCCTGCACTTTGTACTGTAGCAGGGACC
ATATTTTCCTGTACAAATTACTTCCGTGTAATCTTCACAGGTGGTGTTGGCAAAAATGGA
TCAACAATAGCA
gtaagtataccttaagattttcaacacttgtttacactaggacttggttttgttgtcatt
ttgttttttatttcaaatgtataaaatcatttgttaatttataatttatacttagccttt
aaagaaactaatgttcaaaacttcaattttatatatacttacccacatttatatgcttta
EXON 7  159 bp
atgaatttatgctgctacttttcattagctcttctagtttgtgatttatagaaattgctg
cctatcaggcaccatgaggttcctgaaagtttgagttgaactgtgaactgttctgcagca
gatccatgtagtatctgatgagtactgaatactattaactcttctcttcactctgtacag
GGAACAAGTGTCCTTTCTCCTTTTCTCCATATTGGATCAGTGATTACATTAGCTGCAATG
ATCTACAAGAAATCTGCAGTTCAGCTTTTTGAAAAGCATCCCTGTCTTTATATACTGACA
TTTGGTTTTGTGTCTGCTAAAATCACTAATAAGCTTGTG
gtaagcacctgagtttttatttgctgtgtttttcactttcatcttattttggatttatgg
ctatagttctcattctgtagcttcataaatggtcctagagtttgccctcttctaatcaga
atctcttgatatcaacatgggaactatttttactcttttgtgaagctacaatttgaagtt
EXON 8  126 bp
acatgatacatccctttctttctcagacgcatttcatattgttgggtttttagttttggg
aattcaacagctattcctaaataattattggaagttgatatctgagcacaatatgattta
ctgtgtagttcacaattgtcctcttatgaaaatgcctacgttattctgttttattcatag
GTTGCACACATGACGAAAAGTGAAATGCATTTGCATGACACAGCATTCATAGGTCCGGCA
CTTTTGTTTCTGGACCAGTATTTTAACAGCTTTATTGATGAATATATTGTACTTTGGATT
GCCCTG
gtaagtattgtactaagtcttatttcatggtttgagggtttgaaggttgcttgttttctt
attttgatgacccagtcatgaaagatcgttcatataattgtaatgatttggaatgtcaga
aatccacataaatggggctgtgtgagagttctatggctttatatttgagccttttatttt
EXON 9  912 bp
atatttgccatctgtctctctaacaaagagtttgtatgtgaaggaaagattgcaaggaaa
ttgaattattttatggaatggaaggtgaatctgtagagagaacagagtccagtcctcttt
actttcaggaagcttagggagagcctaaacgggtgctgagaatgtctcttttctttccag
GTTTTCTCTTTCTTTGATTTGATCCGCTACTGTGTCAGTGTTTGCAATCAGATTGCGTCT
CACCTGCACATACATGTCTTCAGAATCAAGGTCTCTACAGCTCATTCTAATCATCATTAA
TGATGTAATTGGTATATAGGAACATCATGTTTTCTGCAGGAAAGAAAGTAACATATTAAG
GAGAATGGGGGTGGATAAGAACAAATATAATTTATAATAATCAATGTTGTATAACTTTTA
TTCTTTATTATTGGTAACACGCCCTAACTATCCTGTGTGAGAATGGGAATTTCAAGTCCC
ATCTTGTAAATTGTATATGTTGTCATGCAGGGTTTGGGCCAAGAAAGCATGCAGAAAAAA
ATGCCATGTGATTGTAATTATCCTGGATTCAGAATAATACTGTGATGGGGAGCCAGATCC
GCAGTGGTGGAGAGTTCTAATGTTGACTGTTTGCAGGCCAAAAGATGATTGCTTTATAAT
TTTAACAAATCATTGTCTTTTAGTAACATCCTTGTTTAGTGTCTTCTCAAGCTTTCTTTA
CTGAGGAATTCAGCTTGTGACACAGATACATCCCACTAGCTTGTGAGGTGGAACTAGTAA
TAAAGACCTTGAATTTGGATTGAAAAGTTTCCTATCTTTACATTGTTGAGGAAGTCCTTT
TTTTTTTTTTTTTTTTTTTAATTGCTCAAGAAATGATTCTCTCACAGGCTTGGGAAATCC
TGTTAGCATGCAGAATAATGTGGTAACTTTGTCAATTTCCCATTTTATTTTTTTAAATAA
ATATATGATCTAAAAGCCAACTTTTTCTCAGTTTTACTCAGTGGAAAGATAAACTAAGTT
TTAATGTTATTTTTTTAAATTTAAGCAAAATTTATTTCTGTTCTTTAATAAATAAGAAAA
TGTGGTCCACTG
cattgttgtgatgtgtcttgtgacatttctattttgtagaaactttaaaaaggagaacta
tgttcatttttcctgtcaatggtttttttgtgttgtagttgtcacctgtgtgattatcaa
tcatttagaaatctcatacccttcccctaaattttcagcaagtgcctgggcctctctaag