Gene CENPF Variant 1
DNA : 61.28 KbNT_021877
mRNA : 10194 bp NM_016343
CDS : 9342 bp NP_057427
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  31 bp
gcggcagtctgagtgcgcaggcgcggattggtccgcagctacttagagtgaccaataggc
gtggaggtaagtttggttgagaccagaagcgggcgaattgggcaccggtggcggctgcgg
gcagtttgaattagactctgggctccagcccgccgaagccgcgccagaactgtactctcc
GAGAGGTCGTTTTCCCGTCCCCGAGAGCAAG
gtgagcgtcctgactgggtccggatcctggccctggcggcgggcggtaggcggcgggcgg
cgtgggggtgccgctggctttttgccggcgggtactgggcggggaggcctctgggatcac
tctcccggccctgtaggtgccggggaccgccccctcccacccgaccgaactggagaatcc
EXON 2  203 bp
cagaatcaattattggttgccacctttcagaggatggagaagataggtattatactttgt
tatcttttgaaatgtggtcttgaaacttgatttttaggggtggttagatagattcattaa
tttctgagactttgtttccttttactgtggtaagaccaacagtctggttattcttttcag
TTTATTTACAAATGTTGGAGTAATAAAGAAGGCAGAACAAAATGAGCTGGGCTTTGGAAG
AATGGAAAGAAGGGCTGCCTACAAGAGCTCTTCAGAAAATTCAAGAGCTTGAAGGACAGC
TTGACAAACTGAAGAAGGAAAAGCAGCAAAGGCAGTTTCAGCTTGACAGTCTCGAGGCTG
CGCTGCAGAAGCAAAAACAGAAG
gtacccctgaagctctggtatttgtagctgttcactcattattgacagagaagtgctggt
atttaaaactgttcactcatttttggattaattatttcatcttctttacatttagagaaa
aatgattttgctgtcttcaggtggtaattcctctcccctcccccacccccaccccaggcc
EXON 3  197 bp
tcaaagaagtttcctatctattggcttcaaagtgtgatcatctaaaatttctgtgttcat
atggcttattgcagctgtatctcaggaatttagtagtcaatgttagactcaggtttacca
ataatacttggtaaattcacaaaataagggagttattgtcttctgaacaattctcattag
GTTGAAAATGAAAAAACCGAGGGTACAAACCTGAAAAGGGAGAATCAAAGATTGATGGAA
ATATGTGAAAGTCTGGAGAAAACTAAGCAGAAGATTTCTCATGAACTTCAAGTCAAGGAG
TCACAAGTGAATTTCCAGGAAGGACAACTGAATTCAGGCAAAAAACAAATAGAAAAACTG
GAACAGGAACTTAAAAG
gtaatattttgggatggtatttatagggatgatatttgtatgtattaatcagatgcgttt
gtcttttcctttaacaatataattattatactttgcaattttttttcctggtagaataag
taatgattcggtctctgtaccgtaacttgaaagagtggaagattaaaaacaaacaaacag
EXON 4  122 bp
gtttatgtctggcacataagttagaccttatgaaatgcctgttggataaatgaaatggtt
aagaattcttagtggatgggtttctttgtaagtttattactctctgggaatgtaaggcat
tgatattctgtagcctttgctctaactgatttgtctgcctcttgggtccttttctaacag
GTGTAAATCTGAGCTTGAAAGAAGCCAACAAGCTGCGCAGTCTGCAGATGTCTCTCTGAA
TCCATGCAATACACCACAAAAAATTTTTACAACTCCACTAACACCAAGTCAATATTATAG
TG
gtaatgcattttcttccttggtatagacagctttttgtttagcttgagattttaattctg
caaaataaatgaattaattcaactttgaattaaacttttaatgtatatgtttaaaaactg
cagccacttgttacatatccatttgcatatctgttgaattatgttgagctactggattga
EXON 5  92 bp
tatgtttttatgtgttttgatatttgagtaatttgatcaatagtttgatctatttcccta
accaaaatgttgtttctactaagatactcatttctagactatcaaaatcgttgttgatct
gtgaattccttcatggaatcaatgactgaaagaaaactgtatttgattgtctgtttctag
GTTCCAAGTATGAAGATCTAAAAGAAAAATATAATAAAGAGGTTGAAGAACGAAAAAGAT
TAGAGGCAGAGGTTAAAGCCTTGCAGGCTAAA
gtaagttaattatgggccctataatagagtatgcagttatagaatactttgatatagaat
agaacaaggttagagaaaaatctgttttacatagagctggcctttttgtgtgtgtgtgtg
ctgagaaaaggttttgggctcagtggaggtgattattttttagttttaaaaatagggtgg
EXON 6  292 bp
ttagaacattccatcactgggtattagacttatggtttacttgacttgatgaatgttctt
tgttggtatgcagtgcaactgttaacttcttgggattatggctttatattctatctgaaa
ataaatagccttgagtatataagatctttaaaggcctctaaagagattctgtttctacag
AAAGCAAGCCAGACTCTTCCACAAGCCACCATGAATCACCGCGACATTGCCCGGCATCAG
GCTTCATCATCTGTGTTCTCATGGCAGCAAGAGAAGACCCCAAGTCATCTTTCATCTAAT
TCTCAAAGAACTCCAATTAGGAGAGATTTCTCTGCATCTTACTTTTCTGGGGAACAAGAG
GTGACTCCAAGTCGATCAACTTTGCAAATAGGGAAAAGAGATGCTAATAGCAGTTTCTTT
GACAATTCTAGCAGTCCTCATCTTTTGGATCAATTAAAAGCGCAGAATCAAG
gtaacattgagctaagttaagtttaaattcactttgcttgaggtaatttcacaggtgatt
tcagatatttttaatcccataaagtgcttatgtgttttgttaggcacatcggtgttcaac
atcctagactggttatgtgaaatatactgtcttttcaataatgataaaaggcatcatagt
EXON 7  203 bp
gaatgcaaatgacaatagaaactaactattgaaattaaatccaattaaagtagcttctgt
atttagtgtaaatatttgtttcgtcaaagatttcagaaaagaataaaacaaatgataagt
tatgaacattttgggaaagatatatatgaattggagtgtgatttttgtttgtggttcaag
AGCTAAGAAACAAGATTAATGAGTTGGAACTACGCCTGCAAGGACATGAAAAAGAAATGA
AAGGCCAAGTGAATAAGTTTCAAGAACTCCAACTCCAACTGGAGAAAGCAAAAGTGGAAT
TAATTGAAAAAGAGAAAGTTTTGAACAAATGTAGGGATGAACTAGTGAGAACAACAGCAC
AATACGACCAGGCGTCAACCAAG
gtacttgacttttcgtgaattactggagaaatcttcatcttttcatacaattatttagaa
agagtattttatacataagtttatgaaatgtcagtaatgttctttgttaatatatattag
gtactcttgatgcaactgaactagaaagctgttttaagttgggcagatccgggatcaagc
EXON 8  126 bp
ttcatggcacaaattaggaagtatttatttaagtgggctaatgctttacatccttgctaa
tagttcctaaacataaattgtgtgctaaaacaattatagcagtttttctaaaacacaaaa
tatttgttcatttatgtgagtaatatttattttgtcttgaacatttttattcattattag
TATACTGCATTGGAACAAAAACTGAAAAAATTGACGGAAGATTTGAGTTGTCAGCGACAA
AATGCAGAAAGTGCCAGATGTTCTCTGGAACAGAAAATTAAGGAAAAAGAAAAGGAGTTT
CAAGAG
gtaaggtaaatggattcatgaggtgtttgtctgaaaggctttttatgggcttttcatagt
ttgatcacttggaaaggggagttgttatcacaatttgggaaattctcttagaggagaaat
gctttgtgagctaaaggtcatcttattttctttcacatcttcacttttgcgcttttttta
EXON 9  129 bp
gcctgagggcagcatggagcaccaaggctgactatgttcatcgttaagtggacagttggc
tcagctccctgctgtctcctgtgctctctgtgcagtcgcctgttaggatgctcatgcctc
accctggagtctccctagcgaaccatcatcaggctgatgcacctgccctttgtttttcag
GAGCTCTCCCGTCAACAGCGTTCTTTCCAAACACTGGACCAGGAGTGCATCCAGATGAAG
GCCAGACTCACCCAGGAGTTACAGCAAGCCAAGAATATGCACAACGTCCTGCAGGCTGAA
CTGGATAAA
gtaggggccgtgtctctctctctctccttaatcatcccctcttgttccttgtacttgtta
cttctctaccataactgacatatgatactttcaaagaaaaagcgctccaccttcactttc
cctatcaaagtggagaatgtacagaaccattctggctctaggtttcctcatctagagaaa
EXON 10  123 bp
cgtcgcaaggtcacattatggtattttaagacatatttagctgtgacgtatactgtatct
cagccaaaatagatggcatccattttgatattccatgaccattttattgtttaagaatac
atgattaatgaaaaagtaaagaacatgaaaatgaaacttggtctctttttctttttgtag
CTCACATCAGTAAAGCAACAGCTAGAAAACAATTTGGAAGAGTTTAAGCAAAAGTTGTGC
AGAGCTGAACAGGCGTTCCAGGCGAGTCAGATCAAGGAGAATGAGCTGAGGAGAAGCATG
GAG
gtaagggaggaggatgccgaattttctccacttatgtaagaaccaagtgcaaggggaaaa
gaatattcctattccatttgtcagttgcttgtcatgactgtgtgcctttttcttttctat
tcaccagaagtaagtattacagaattttctgtatataacccatgacagaatatgattgct
EXON 11  136 bp
ctgttcataacattatttaagtaagaatgtctgacttcattaggtactcaaacggggaaa
ttgtgattctttccctagtgagatacacaaacagttctgctagggacctttattaaggca
gaagtcataacttacttgagcattcgttttggctataaccaattaaaatgtgtgttttag
GAAATGAAGAAGGAAAACAACCTCCTTAAGAGTCACTCTGAGCAAAAGGCCAGAGAAGTC
TGCCACCTGGAGGCAGAACTCAAGAACATCAAACAGTGTTTAAATCAGAGCCAGAATTTT
GCAGAAGAAATGAAAG
gtaagtaaacttagtattttagagttacctttctaagctgctattcccgtgagaggggat
ggatggcattaacatattagagaaactctttggattttttttcatatattccctcaaaaa
gatgtgcgcagttgatgtggaagagttttccctcttctagtttttagtttccagagtgag
EXON 12  3404 bp
aagataattaccaagtgatccactttctaggaggtacccaggcaataatgccagtttttc
cagggcttgagtagttgttagtttgtttggattttgccagggggcggggggaggggttag
cgtttctgtagaataaacatttattacaaacattgacgacttttatttatttttaaatag
CGAAGAATACCTCTCAGGAAACCATGTTAAGAGATCTTCAAGAAAAAATAAATCAGCAAG
AAAACTCCTTGACTTTAGAAAAACTGAAGCTTGCTGTGGCTGATCTGGAAAAGCAGCGAG
ATTGTTCTCAAGACCTTTTGAAGAAAAGAGAACATCACATTGAACAACTTAATGATAAGT
TAAGCAAGACAGAGAAAGAGTCCAAAGCCTTGCTGAGTGCTTTAGAGTTAAAAAAGAAAG
AATATGAAGAATTGAAAGAAGAGAAAACTCTGTTTTCTTGTTGGAAAAGTGAAAACGAAA
AACTTTTAACTCAGATGGAATCAGAAAAGGAAAACTTGCAGAGTAAAATTAATCACTTGG
AAACTTGTCTGAAGACACAGCAAATAAAAAGTCATGAATACAACGAGAGAGTAAGAACGC
TGGAGATGGACAGAGAAAACCTAAGTGTCGAGATCAGAAACCTTCACAACGTGTTAGACA
GTAAGTCAGTGGAGGTAGAGACCCAGAAACTAGCTTATATGGAGCTACAGCAGAAAGCTG
AGTTCTCAGATCAGAAACATCAGAAGGAAATAGAAAATATGTGTTTGAAGACTTCTCAGC
TTACTGGGCAAGTTGAAGATCTAGAACACAAGCTTCAGTTACTGTCAAATGAAATAATGG
ACAAAGACCGGTGTTACCAAGACTTGCATGCCGAATATGAGAGCCTCAGGGATCTGCTAA
AATCCAAAGATGCTTCTCTGGTGACAAATGAAGATCATCAGAGAAGTCTTTTGGCTTTTG
ATCAGCAGCCTGCCATGCATCATTCCTTTGCAAATATAATTGGAGAACAAGGAAGCATGC
CTTCAGAGAGGAGTGAATGTCGTTTAGAAGCAGACCAAAGTCCGAAAAATTCTGCCATCC
TACAAAATAGAGTTGATTCACTTGAATTTTCATTAGAGTCTCAAAAACAGATGAACTCAG
ACCTGCAAAAGCAGTGTGAAGAGTTGGTGCAAATCAAAGGAGAAATAGAAGAAAATCTCA
TGAAAGCAGAACAGATGCATCAAAGTTTTGTGGCTGAAACAAGTCAGCGCATTAGTAAGT
TACAGGAAGACACTTCTGCTCACCAGAATGTTGTTGCTGAAACCTTAAGTGCCCTTGAGA
ACAAGGAAAAAGAGCTGCAACTTTTAAATGATAAGGTAGAAACTGAGCAGGCAGAGATTC
AAGAATTAAAAAAGAGCAACCATCTACTTGAAGACTCTCTAAAGGAGCTACAACTTTTAT
CCGAAACCCTAAGCTTGGAGAAGAAAGAAATGAGTTCCATCATTTCTCTAAATAAAAGGG
AAATTGAAGAGCTGACCCAAGAGAATGGGACTCTTAAGGAAATTAATGCATCCTTAAATC
AAGAGAAGATGAACTTAATCCAGAAAAGTGAGAGTTTTGCAAACTATATAGATGAAAGGG
AGAAAAGCATTTCAGAGTTATCTGATCAGTACAAGCAAGAAAAACTTATTTTACTACAAA
GATGTGAAGAAACCGGAAATGCATATGAGGATCTTAGTCAAAAATACAAAGCAGCACAGG
AAAAGAATTCTAAATTAGAATGCTTGCTAAATGAATGCACTAGTCTTTGTGAAAATAGGA
AAAATGAGTTGGAACAGCTAAAGGAAGCATTTGCAAAGGAACACCAAGAATTCTTAACAA
AATTAGCATTTGCTGAAGAAAGAAATCAGAATCTGATGCTAGAGTTGGAGACAGTGCAGC
AAGCTCTGAGATCTGAGATGACAGATAACCAAAACAATTCTAAGAGCGAGGCTGGTGGTT
TAAAGCAAGAAATCATGACTTTAAAGGAAGAACAAAACAAAATGCAAAAGGAAGTTAATG
ACTTATTACAAGAGAATGAACAGCTGATGAAGGTAATGAAGACTAAACATGAATGTCAAA
ATCTAGAATCAGAACCAATTAGGAACTCTGTGAAAGAAAGAGAGAGTGAGAGAAATCAAT
GTAATTTTAAACCTCAGATGGATCTTGAAGTTAAAGAAATTTCTCTAGATAGTTATAATG
CGCAGTTGGTGCAATTAGAAGCTATGCTAAGAAATAAGGAATTAAAACTTCAGGAAAGTG
AGAAGGAGAAGGAGTGCCTGCAGCATGAATTACAGACAATTAGAGGAGATCTTGAAACCA
GCAATTTGCAAGACATGCAGTCACAAGAAATTAGTGGCCTTAAAGACTGTGAAATAGATG
CGGAAGAAAAGTATATTTCAGGGCCTCATGAGTTGTCAACAAGTCAAAACGACAATGCAC
ACCTTCAGTGCTCTCTGCAAACAACAATGAACAAGCTGAATGAGCTAGAGAAAATATGTG
AAATACTGCAGGCTGAAAAGTATGAACTCGTAACTGAGCTGAATGATTCAAGGTCAGAAT
GTATCACAGCAACTAGGAAAATGGCAGAAGAGGTAGGGAAACTACTAAATGAAGTTAAAA
TATTAAATGATGACAGTGGTCTTCTCCATGGTGAGTTAGTGGAAGACATACCAGGAGGTG
AATTTGGTGAACAACCAAATGAACAGCACCCTGTGTCTTTGGCTCCATTGGACGAGAGTA
ATTCCTACGAGCACTTGACATTGTCAGACAAAGAAGTTCAAATGCACTTTGCCGAATTGC
AAGAGAAATTCTTATCTTTACAAAGTGAACACAAAATTTTACATGATCAGCACTGTCAGA
TGAGCTCTAAAATGTCAGAGCTGCAGACCTATGTTGACTCATTAAAGGCCGAAAATTTGG
TCTTGTCAACGAATCTGAGAAACTTTCAAGGTGACTTGGTGAAGGAGATGCAGCTGGGCT
TGGAGGAGGGGCTCGTTCCATCCCTGTCATCCTCTTGTGTGCCTGACAGCTCTAGTCTTA
GCAGTTTGGGAGACTCCTCCTTTTACAGAGCTCTTTTAGAACAGACAGGAGATATGTCTC
TTTTGAGTAATTTAGAAGGGGCTGTTTCAGCAAACCAGTGCAGTGTAGATGAAGTATTTT
GCAGCAGTCTGCAGGAGGAGAATCTGACCAGGAAAGAAACCCCTTCGGCCCCAGCGAAGG
GTGTTGAAGAGCTTGAGTCCCTCTGTGAGGTGTACCGGCAGTCCCTCGAGAAGCTAGAAG
AGAAAATGGAAAGTCAAGGGATTATGAAAAATAAGGAAATTCAAGAGCTCGAGCAGTTAT
TAAGTTCTGAAAGGCAAGAGCTTGACTGCCTTAGGAAGCAGTATTTGTCAGAAAATGAAC
AGTGGCAACAGAAGCTGACAAGCGTGACTCTGGAGATGGAGTCCAAGTTGGCGGCAGAAA
AGAAACAGACGGAACAACTGTCACTTGAGCTGGAAGTAGCACGACTCCAGCTACAAGGTC
TGGACTTAAGTTCTCGGTCTTTGCTTGGCATCGACACAGAAGAT
gtaagtacctgggatttaaatgccatttctcggtttacatgactagtggacactcagtaa
atgtttgtctaattgaaatgtacattaaacctaagttaaaatatttttagggttcaagga
aataaaatacaccaaaatattttcaaaacaaaccagaacttgaggaaaatgagtaaacgt
EXON 13  2844 bp
acgtataagtatgttgaacatttgaatgaagagagaaagatgtagtgggaaattcaccac
tttaagagatgtgtttagcagaggccacgcatcagtttctaaaaagtaataactaaatct
attctattttgattctttttgaaaaataaaatgcatgcttgttatgtattataattacag
GCTATTCAAGGCCGAAATGAGAGCTGTGACATATCAAAAGAACATACTTCAGAAACTACA
GAAAGAACACCAAAGCATGATGTTCATCAGATTTGTGATAAAGATGCTCAGCAGGACCTC
AATCTAGACATTGAGAAAATAACTGAGACTGGTGCAGTGAAACCCACAGGAGAGTGCTCT
GGGGAACAGTCCCCAGATACCAATTATGAGCCTCCAGGGGAAGATAAAACCCAGGGCTCT
TCAGAATGCATTTCTGAATTGTCATTTTCTGGTCCTAATGCTTTGGTACCTATGGATTTC
CTGGGGAATCAGGAAGATATCCATAATCTTCAACTGCGGGTAAAAGAGACATCAAATGAG
AATTTGAGATTACTTCATGTGATAGAGGACCGTGACAGAAAAGTTGAAAGTTTGCTAAAT
GAAATGAAAGAATTAGACTCAAAACTCCATTTACAGGAGGTACAACTAATGACCAAAATT
GAAGCATGCATAGAATTGGAAAAAATAGTTGGGGAACTTAAGAAAGAAAACTCAGATTTA
AGTGAAAAATTGGAATATTTTTCTTGTGATCACCAGGAGTTACTCCAGAGAGTAGAAACT
TCTGAAGGCCTCAATTCTGATTTAGAAATGCATGCAGATAAATCATCACGTGAAGATATT
GGAGATAATGTGGCCAAGGTGAATGACAGCTGGAAGGAGAGATTTCTTGATGTGGAAAAT
GAGCTGAGTAGGATCAGATCGGAGAAAGCTAGCATTGAGCATGAAGCCCTCTACCTGGAG
GCTGACTTAGAGGTAGTTCAAACAGAGAAGCTATGTTTAGAAAAAGACAATGAAAATAAG
CAGAAGGTTATTGTCTGCCTTGAAGAAGAACTCTCAGTGGTCACAAGTGAGAGAAACCAG
CTTCGTGGAGAATTAGATACTATGTCAAAAAAAACCACGGCACTGGATCAGTTGTCTGAA
AAAATGAAGGAGAAAACACAAGAGCTTGAGTCTCATCAAAGTGAGTGTCTCCATTGCATT
CAGGTGGCAGAGGCAGAGGTGAAGGAAAAGACGGAACTCCTTCAGACTTTGTCCTCTGAT
GTGAGTGAGCTGTTAAAAGACAAAACTCATCTCCAGGAAAAGCTGCAGAGTTTGGAAAAG
GACTCACAGGCACTGTCTTTGACAAAATGTGAGCTGGAAAACCAAATTGCACAACTGAAT
AAAGAGAAAGAATTGCTTGTCAAGGAATCTGAAAGCCTGCAGGCCAGACTGAGTGAATCA
GATTATGAAAAGCTGAATGTCTCCAAGGCCTTGGAGGCCGCACTGGTGGAGAAAGGTGAG
TTCGCATTGAGGCTGAGCTCAACACAGGAGGAAGTGCATCAGCTGAGAAGAGGCATCGAG
AAACTGAGAGTTCGCATTGAGGCCGATGAAAAGAAGCAGCTGCACATCGCAGAGAAACTG
AAAGAACGCGAGCGGGAGAATGATTCACTTAAGGATAAAGTTGAGAACCTTGAAAGGGAA
TTGCAGATGTCAGAAGAAAACCAGGAGCTAGTGATTCTTGATGCCGAGAATTCCAAAGCA
GAAGTAGAGACTCTAAAAACACAAATAGAAGAGATGGCCAGAAGCCTGAAAGTTTTTGAA
TTAGACCTTGTCACGTTAAGGTCTGAAAAAGAAAATCTGACAAAACAAATACAAGAAAAA
CAAGGTCAGTTGTCAGAACTAGACAAGTTACTCTCTTCATTTAAAAGTCTGTTAGAAGAA
AAGGAGCAAGCAGAGATACAGATCAAAGAAGAATCTAAAACTGCAGTGGAGATGCTTCAG
AATCAGTTAAAGGAGCTAAATGAGGCAGTAGCAGCCTTGTGTGGTGACCAAGAAATTATG
AAGGCCACAGAACAGAGTCTAGACCCACCAATAGAGGAAGAGCATCAGCTGAGAAATAGC
ATTGAAAAGCTGAGAGCCCGCCTAGAAGCTGATGAAAAGAAGCAGCTCTGTGTCTTACAA
CAACTGAAGGAAAGTGAGCATCATGCAGATTTACTTAAGGGTAGAGTGGAGAACCTTGAA
AGAGAGCTAGAGATAGCCAGGACAAACCAAGAGCATGCAGCTCTTGAGGCAGAGAATTCC
AAAGGAGAGGTAGAGACCCTAAAAGCAAAAATAGAAGGGATGACCCAAAGTCTGAGAGGT
CTGGAATTAGATGTTGTTACTATAAGGTCAGAAAAAGAAAATCTGACAAATGAATTACAA
AAAGAGCAAGAGCGAATATCTGAATTAGAAATAATAAATTCATCATTTGAAAATATTTTG
CAAGAAAAAGAGCAAGAGAAAGTACAGATGAAAGAAAAATCAAGCACTGCCATGGAGATG
CTTCAAACACAATTAAAAGAGCTCAATGAGAGAGTGGCAGCCCTGCATAATGACCAAGAA
GCCTGTAAGGCCAAAGAGCAGAATCTTAGTAGTCAAGTAGAGTGTCTTGAACTTGAGAAG
GCTCAGTTGCTACAAGGCCTTGATGAGGCCAAAAATAATTATATTGTTTTGCAATCTTCA
GTGAATGGCCTCATTCAAGAAGTAGAAGATGGCAAGCAGAAACTGGAGAAGAAGGATGAA
GAAATCAGTAGACTGAAAAATCAAATTCAAGACCAAGAGCAGCTTGTCTCTAAACTGTCC
CAGGTGGAAGGAGAGCACCAACTTTGGAAGGAGCAAAACTTAGAACTGAGAAATCTGACA
GTGGAATTGGAGCAGAAGATCCAAGTGCTACAATCCAAAAATGCCTCTTTGCAGGACACA
TTAGAAGTGCTGCAGAGTTCTTACAAGAATCTAGAGAATGAGCTTGAATTGACAAAAATG
GACAAAATGTCCTTTGTTGAAAAA
gtaagtggctatatctgtttatgtttaaatatgtagtcatgaggcaggaaaccatatttt
cttctagacactgtgaattgtatttacttctagaccgtgtctgctatattggaccaaact
ttgtaaaggctttatgtttactgggtcttgaattgcagaaacactgagttggctctggca
EXON 14  153 bp
taagcttactagtaggttttgagaatgttgagttgagtggattagtaaaggcgggattag
ccagcttccattttatgattgaaggctaaaataaatggcatgaatatgttgtatcagagt
ggtcgatctgatcaaaacagaccaccaaaaagcagattctaatgaaagatgaaatttcag
GTAAACAAAATGACTGCAAAGGAAACTGAGCTGCAGAGGGAAATGCATGAGATGGCACAG
AAAACAGCAGAGCTGCAAGAAGAACTCAGTGGAGAGAAAAATAGGCTAGCTGGAGAGTTG
CAGTTACTGTTGGAAGAAATAAAGAGCAGCAAA
gtaagtttctttgtgacaagtgttattatgatctgttaattcattgtgcacactctcctt
attggttcctgtaagaccttctgttgtttacctaacttatttttagctcttgaaaaaaat
aaccctgtgcttatgtcataatctgatttatagtaatctctaccatccagcactatcagg
EXON 15  177 bp
tggaggtgaagtcacaattaaaagtgaatacattgctaaggattatagcactattctgta
cagattttatcttgcccataaatattttttttctacacagtacacattatttcctaaaaa
tatttccaggttcttaattatgaggaggtgctattatgattttattatttttctgtttag
GATCAATTGAAGGAGCTCACACTAGAAAATAGTGAATTGAAGAAGAGCCTAGATTGCATG
CACAAAGACCAGGTGGAAAAGGAAGGGAAAGTGAGAGAGGAAATAGCTGAATATCAGCTA
CGGCTTCATGAAGCTGAAAAGAAACACCAGGCTTTGCTTTTGGACACAAACAAACAG
gtgaaatgtggggtttggttactgggggagctggagagtgtattttgatcatggtaaggc
ttttttttttttccaaaaaaaatcaatattctgggttattactatgctatataatctttt
aaaaggtctcacattaacttcacgatcttttccccaggtccctctcttattttatcagtt
EXON 16  162 bp
ttggccaggatggccttgaactcctgacctcgtgatctgcccaccttggcctcccaaagt
gctgggattacaggtgtgaaacactgcgcccagctgttttttgtttttctgactattttt
ttttagctgtgcctcctggctaaagtaacattttggttttttttgtttgttttgctctag
TATGAAGTAGAAATCCAGACATACCGAGAGAAATTGACTTCTAAAGAAGAATGTCTCAGT
TCACAGAAGCTGGAGATAGACCTTTTAAAGTCTAGTAAAGAAGAGCTCAATAATTCATTG
AAAGCTACTACTCAGATTTTGGAAGAATTGAAGAAAACCAAG
gtatgttcactttaatttgcttcatgatttcgaatggtttatacaggtggtagtgatttt
aatggtatagcattaaacgttttcattttcattttatgaaaatttttggtagtcaaaaat
gatgtcattcatcagttctctgctgagttatctttaaaaaaaatcagtgggtcatctaca
EXON 17  163 bp
tggggggacttaggaaactgagtagagaacgtgaatggttttgtgcatctttagatgttt
tgtattgaatctaataattcttaaatttacaatatatgaatcttatatcttataattatt
tttccatatgcttataaaaagaaattcaaggttttaaatggaattacttttattttgtag
ATGGACAATCTAAAATATGTAAATCAGTTGAAGAAGGAAAATGAACGTGCCCAGGGGAAA
ATGAAGTTGTTGATCAAATCCTGTAAACAGCTGGAAGAGGAAAAGGAGATACTGCAGAAA
GAACTCTCTCAACTTCAAGCTGCACAGGAGAAGCAGAAAACAG
gtgggtgttaactggggcacatcaactagccagaactcttttccagtagtgaaataacat
atggtatgcgtgcataggaactatttttagtgctgtgttctattactgagtgctgatttt
ttaccattaatccattttccaatttctgaattttgtgcttatcttgggatcattatagga
EXON 18  477 bp
atgatatacctcccgaacaagagttgtttgaactataagaacatatacagatatatctcc
ccaacctcttaaaaaaaaaaatcaaagaaagaacacgtctaagattatctgcttcacgat
gcccattgttaactagagaagcatcaagttgcacatgatgtgttgctttactttggacag
GTACTGTTATGGATACCAAGGTCGATGAATTAACAACTGAGATCAAAGAACTGAAAGAAA
CTCTTGAAGAAAAAACCAAGGAGGCAGATGAATACTTGGATAAGTACTGTTCCTTGCTTA
TAAGCCATGAAAAGTTAGAGAAAGCTAAAGAGATGTTAGAGACACAAGTGGCCCATCTGT
GTTCACAGCAATCTAAACAAGATTCCCGAGGGTCTCCTTTGCTAGGTCCAGTTGTTCCAG
GACCATCTCCAATCCCTTCTGTTACTGAAAAGAGGTTATCATCTGGCCAAAATAAAGCTT
CAGGCAAGAGGCAAAGATCCAGTGGAATATGGGAGAATGGTAGAGGACCAACACCTGCTA
CCCCAGAGAGCTTTTCTAAAAAAAGCAAGAAAGCAGTCATGAGTGGTATTCACCCTGCAG
AAGACACGGAAGGTACTGAGTTTGAGCCAGAGGGACTTCCAGAAGTTGTAAAGAAAG
gtatgcctaatttaaagacaaaattatttgtgttcttttgaaattccatataatggttca
catataaaaagacaaaagtatttgcttttttacattattgtgcaataatctcattgacgt
tcataagcaatagtctgcttttaaatggatgaggcatatgttttcctctaggatctaatt
EXON 19  179 bp
tttgattcaatttggtgactcccagggcaactgtgaagtgtaatccattgaccacagtgg
ctaggacaaagtattttttggagtttgcattatccttgttaaaaccacctaatgaatatc
ttttccactgtagatagaattggacctagcagtgctgacagttattttttttgcccttag
GGTTTGCTGACATCCCGACAGGAAAGACTAGCCCATATATCCTGCGAAGAACAACCATGG
CAACTCGGACCAGCCCCCGCCTGGCTGCACAGAAGTTAGCGCTATCCCCACTGAGTCTCG
GCAAAGAAAATCTTGCAGAGTCCTCCAAACCAACAGCTGGTGGCAGCAGATCACAAAAG
gtaaactactgtcaacatccgtctactgtttgagatccagaaaattgcagtagtacctgg
gtgaggattggacactgcacccccgattcaggagcgctttcaaaaagtctgaccttcttg
gtgtggtgtaagtcagtcagtagtgagcaagtgaccgggtgagcattacagtatcagggt
EXON 20  981 bp
gtatcctcctaagttctctgttagatggggcctgttctcaaggaagaggaaatacttcaa
ttatatataactcctagagaagaagaacttaatttaaaacttagtgacatagtgctttat
ttttcatgttgtggaaatgtgaatgtgattgaacctctaacagagatgtttgtgttgcag
GTCAAAGTTGCTCAGCGGAGCCCAGTAGATTCAGGCACCATCCTCCGAGAACCCACCACG
AAATCCGTCCCAGTCAATAATCTTCCTGAGAGAAGTCCGACTGACAGCCCCAGAGAGGGC
CTGAGGGTCAAGCGAGGCCGACTTGTCCCCAGCCCCAAAGCTGGACTGGAGTCCAACGGC
AGTGAGAACTGTAAGGTCCAGTGAAGGCACTTTGTGTGTCAGTACCCCTGGGAGGTGCCA
GTCATTGAATAGATAAGGCTGTGCCTACAGGACTTCTCTTTAGTCAGGGCATGCTTTATT
AGTGAGGAGAAAACAATTCCTTAGAAGTCTTAAATATATTGTACTCTTTAGATCTCCCAT
GTGTAGGTATTGAAAAAGTTTGGAAGCACTGATCACCTGTTAGCATTGCCATTCCTCTAC
TGCAATGTAAATAGTATAAAGCTATGTATATAAAGCTTTTTGGTAATATGTTACAATTAA
AATGACAAGCACTATATCACAATCTCTGTTTGTATGTGGGTTTTACACTAAAAAAATGCA
AAACACATTTTATTCTTCTAATTAACAGCTCCTAGGAAAATGTAGACTTTTGCTTTATGA
TATTCTATCTGTAGTATGAGGCATGGAATAGTTTTGTATCGGGAATTTCTCAGAGCTGAG
TAAAATGAAGGAAAAGCATGTTATGTGTTTTTAAGGAAAATGTGCACACATATACATGTA
GGAGTGTTTATCTTTCTCTTACAATCTGTTTTAGACATCTTTGCTTATGAAACCTGTACA
TATGTGTGTGTGGGTATGTGTTTATTTCCAGTGAGGGCTGCAGGCTTCCTAGAGGTGTGC
TATACCATGCGTCTGTCGTTGTGCTTTTTTCTGTTTTTAGACCAATTTTTTACAGTTCTT
TGGTAAGCATTGTCGTATCTGGTGATGGATTAACATATAGCCTTTGTTTTCTAATAAAAT
AGTCGCCTTCGTTTTCTGTAA
gaatgattcctaagtgtaaaggcattcgaatattggtactatttcttgctaattacaaca
gcctcttatacacgtgaaaatgtttgaacaaatgatacagatctttaaacaaatgatctt
agcatctttagttgtattaaaagacacaatttggaatacgggtcataaggagtatatggg