Gene CD1B Variant 1
DNA : 3.48 KbNT_079484
mRNA : 1294 bp NM_001764
CDS : 1002 bp NP_001755
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  106 bp
ggggtaagagaaactctaaaaatcagggcttgagggaaataaaaggtgaggtaagaggct
cagggctgtgggaggcacatttttctctgaaaagcagtttggatgaggaagagatttggc
agttggaagagagaagaagtcactacagggtactgaggaaaagctttgctgaaattggag
ATCAAATACCAGCTCTGCCAGTAAGAAGTTGCATCTCCCAGTGAAATGCTGCTGCTGCCA
TTTCAACTGTTAGCTGTTCTCTTTCCTGGTGGTAACAGTGAACATG
gtaagagtcactctggcagctcccagcactggtgcaggggtttggattttaaaaagcaag
cagggctttcctaggtgcaattggacactaagggtctgggtctttctgtctcccgccctc
ttcaaccattctggtggttgggactagaacctgaagccttaaggcagtcaaatgtgtcag
EXON 2  267 bp
ttcaaccattctggtggttgggactagaacctgaagccttaaggcagtcaaatgtgtcag
acttcctgtgttctttagactctaggttcttgttttctaaatcattttcattcccattct
tcctaattgtctcctgcttctctctttatcttcaccatcttgcttttccactcttcacag
CCTTCCAGGGGCCGACCTCCTTTCATGTTATCCAGACCTCGTCCTTTACCAATAGTACCT
GGGCACAAACTCAAGGCTCAGGCTGGTTGGATGATTTGCAGATTCATGGCTGGGATAGCG
ACTCAGGCACTGCCATATTCCTGAAGCCTTGGTCTAAAGGTAACTTTAGTGATAAGGAGG
TTGCTGAGTTAGAGGAGATATTCCGAGTCTACATCTTTGGATTCGCTCGAGAAGTACAAG
ACTTTGCCGGTGATTTCCAGATGAAAT
gtgagtctagtccaccgaactgggaagagtctcaaggactctcttttctctcttttttgc
aaagtgttgctctctctgatgcttctcccttcctttctattttacccaaatgcacgcaca
tgcttttcttgagtagtctctcactccagcttcacaccatcacacctcatatttcagatt
EXON 3  279 bp
cacatttttctcaatgctcttgtttctgaaaatgtctaaatgttatcattagtttttagc
tcatcatcattttacaccaaataactttatccccaccaaaatctaaaatcctaggttctt
ttctcatgcctttttttcttatttgtgtttaataacttgctctcttttccctctacatag
ACCCCTTTGAGATCCAGGGCATAGCAGGCTGTGAGCTACATTCTGGAGGTGCCATAGTAA
GCTTCCTGAGGGGAGCTCTAGGAGGATTGGATTTCCTGAGTGTCAAGAATGCTTCATGTG
TGCCTTCCCCAGAAGGTGGCAGCAGGGCACAGAAATTCTGTGCACTAATCATACAATATC
AAGGTATCATGGAAACTGTGAGAATTCTCCTCTATGAAACCTGCCCCCGATATCTCTTGG
GCGTCCTCAATGCAGGAAAAGCAGATCTGCAAAGACAAG
gttagtcctgctgttatttcacttcccaccacctcctctaagatcaagagtaggaagata
tcaaaggataggagcttaaataacaagttatttggttcccaaaggagtgaatggggtcgc
tgtccaagcttgtaggtttctgagttcataacctctgaactcgagttataacatgacact
EXON 4  279 bp
tcccaccacctcctctaagatcaagagtaggaagatatcaaaggataggagcttaaataa
caagttatttggttcccaaaggagtgaatggggtcgctgtccaagcttgtaggtttctga
gttcataacctctgaactcgagttataacatgacacttttttttctccttcctgccttag
TGAAGCCTGAGGCCTGGCTGTCCAGTGGCCCCAGTCCTGGACCTGGCCGTCTGCAGCTTG
TGTGCCATGTCTCAGGATTCTACCCAAAGCCCGTGTGGGTGATGTGGATGCGGGGTGAGC
AGGAGCAGCAGGGCACTCAGCTAGGGGACATCCTGCCCAATGCTAACTGGACATGGTATC
TCCGAGCAACCCTGGATGTGGCAGATGGGGAGGCGGCTGGCCTGTCCTGTCGGGTGAAGC
ACAGCAGTTTAGAGGGCCAGGACATCATCCTCTACTGGA
gtaagaaatagcagggacccaggctggaaatgccaggaagtgatcttcaggcatagaggg
aggcactggggaaggatagagcttgagagatgaaagagggagagattgattgattgattt
ccctgaccccaatcccaacaggagtaaaaatagataatccaagttatcaaaaatgtagga
EXON 5  94 bp
taggaattaaggacctgtaaactgggtagaggggatcaaaggatggatatatggtggcca
ggaatatgagagaggaagttggaaatgaccatacattggaagtaggtgggcaaaggaagg
ccaaggaattctgtgtatagtatctgaagtgacatccttttgtcctctctcaattgccag
GAAACCCCACCTCCATTGGCTCAATTGTTTTGGCAATAATAGTGCCTTCCTTGCTCCTTT
TGCTATGCCTTGCATTATGGTATATGAGGCGCCG
gtgagttgtgggtggtgttgtttttttttttaatatgtcttttctgttcacccttccact
gttttttaccattttatctatttaaaaattgtttatcctcaatcctttcaccatatcctt
tccccaaactcccattcgttttatgtggacttaaaaaaaattctgttaaaatacacataa
EXON 6  269 bp
tccttttttgaaactgaacaatattccaccatatgcgtataacacattttgttcatccat
tcgtctatctatggacacttgggttgctttcacttttaactatcatgaataatattacta
tgagcatgggtgtacaaacatcttttatgtggagctcttttgttcttctgtttttaacag
GTCATATCAGAATATCCCATGAGCCATCATCATGTCTCCTCTCCCATTCGCAATAAGTAC
CAAGAAGCCCAAGATATCAGCCCAAAAGTCAATCTTATCATATTTCAAATGATTTTCAAA
TTTGATGAAATCAGAGTTTTCATGTATTTTAAAATAAATTATTATTTAAACATCAGCAAA
AAAGTACTTAAAACTGTAAATTTATTATGAGACTGTACTAACAGTGTGATTCACCCTGAT
TTTACACACATTAAAATGTTAGAAAAAAT
gtgtctcaaaataaatgaaatataatacatatgacttaatggtgactccctttggcttcc
taatttaaaacttttctttttctgcttctggttaaatatcatttgtcaaagaaaaccaaa
tataattatgccagaatcactgtatttgcagagatgcagagccttttggatgtaatttct