Gene CASP9 Variant 2
DNA : 32.00 KbNT_004873
mRNA : 1993 bp NM_001229
CDS : 1251 bp NP_001220
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  227 bp
gtgttctggggcggcgcggtgatgggaggcttggccctgggggcggggcgaggcgcagag
gtgcgtcctgagggcggggcggtgacgcaagagcgactcctgggggcggggcgaggcctt
ggagatgcgtccggaggcggtggggagcgaagactgacccggggccgtgacgcgggggca
GGCCCTGGGGCGGGGGCGGGTCCTGGGGACTGGGGCGGGCGGCCGAGGCCCGGAAGCGGA
CTGAGGCGGCCTGGAGTCTTAGTTGGCTACTCGCCATGGACGAAGCGGATCGGCGGCTCC
TGCGGCGGTGCCGGCTGCGGCTGGTGGAAGAGCTGCAGGTGGACCAGCTCTGGGACGCCC
TGCTGAGCCGCGAGCTGTTCAGGCCCCATATGATCGAGGACATCCAG
gtgcgcccccggccccctgtccccgcgctgcacggccgggtccccacgcccctcgaggag
gcgttgtgcgggagcctagccttccctgtggcttcaaacccctcagcggagccaaagaat
cccaaacacctcttagtcgggtgttcgctaaagcgattccatgccatactcagtcagcgt
EXON 2  286 bp
ccctgcaaaataatgaacagatcagcaaaggctggtaaatggcacacagtgcacctgcag
ctccattgctgcccacgtgcctgattgtttagacttacagtagctgggaaatggggagac
aaggtgagagccatataaaagtacgtggataattagtatcctgcctttctttccaaacag
CGGGCAGGCTCTGGATCTCGGCGGGATCAGGCCAGGCAGCTGATCATAGATCTGGAGACT
CGAGGGAGTCAGGCTCTTCCTTTGTTCATCTCCTGCTTAGAGGACACAGGCCAGGACATG
CTGGCTTCGTTTCTGCGAACTAACAGGCAAGCAGCAAAGTTGTCGAAGCCAACCCTAGAA
AACCTTACCCCAGTGGTGCTCAGACCAGAGATTCGCAAACCAGAGGTTCTCAGACCGGAA
ACACCCAGACCAGTGGACATTGGTTCTGGAGGATTTGGTGATGTCG
gtaagtagcaagagagtgattggtgggtgggcatgacacgtagtcatttgggactcacta
tgagtacagctgggtgggctgagattcagaatttaattttagcattgtctttctgaatgt
tcatagggatggcaaaattctgggaggttttcaggaggttgaatcttggcagcccctcct
EXON 3  35 bp
gtgtgtgtttaactttgttagaaacctctaaacagatctccaaggtggctctcccaccag
cagagtctgagggtctgagttctcgctgctccgttcttggggggctgtcctcacagagcc
ccttgcccctcctctgctgtaacccaacattcatgtttctctctttctctgcctcttcag
GTGCTCTTGAGAGTTTGAGGGGAAATGCAGATTTG
gtgagtctccatgaaatttgggccagtagctcgggctctgggcccttccctccccacccc
tcaggtccttccctgcaggtgtgtcaggagcccagggaacccaaccctaggcagtgcagt
gggggtctggtctcagcctccctgactccggcccagcgcctgctggggcagattgttcat
EXON 4  177 bp
ggggtcaccttctagtgctagtcttccctgcagttgcttctcttttgccctggaatgccg
ggtggagaccctgctactccttgtgcgagagggcagaccccgttttcttcccgcctctcc
agactgtcctctagggagcgtggggagagcccgggtttacgtgggtccctgtgctggcag
GCTTACATCCTGAGCATGGAGCCCTGTGGCCACTGCCTCATTATCAACAATGTGAACTTC
TGCCGTGAGTCCGGGCTCCGCACCCGCACTGGCTCCAACATCGACTGTGAGAAGTTGCGG
CGTCGCTTCTCCTCGCTGCATTTCATGGTGGAGGTGAAGGGCGACCTGACTGCCAAG
gtacactcactatctgtggagggagacagggtggggggcagtgggtggggaagtatcttt
tgagggactccaaaagccagctgactccccaggcgagcccttacatctggaggaccatgg
gaggtaggacggcccagcggctacaggttcaagttcagacgcagaagtccgggtttgagg
EXON 5  90 bp
ccaggctggtctcgaactcgtgacctcaaatgatccacctgccttggcctcccaaagtgc
tgggattacaggcgtgaaccaccatgcctggccaggctgggcccttttattgttaggaac
ggtccagtctgcatctagacctatccgtgcttctggctcacctgcagccctctcttgtag
AAAATGGTGCTGGCTTTGCTGGAGCTGGCGCAGCAGGACCACGGTGCTCTGGACTGCTGC
GTGGTGGTCATTCTCTCTCACGGCTGTCAG
gtaggaagcctcccactgttccctgggcaggcattgggtactggccgtgccaagaggctg
tgcaggggccatgtcccttcttgtgtccaaaacacccttggctttgtggaaaagggctgt
ggggccctgcccacctcctgttgttttcttgggagccatgtggtcctctgaggagttggc
EXON 6  148 bp
tcaaggtgtctttccagatgctgaccagggtctttccagaaccaacctgctctgtctcaa
tcagcctcgtgcccctggctttgaccttccaaatccttggctcccacaaaacctctgaac
aggctgttggattcctactccaacttcttggttttgtaaccagggttcttggtcttctag
GCCAGCCACCTGCAGTTCCCAGGGGCTGTCTACGGCACAGATGGATGCCCTGTGTCGGTC
GAGAAGATTGTGAACATCTTCAATGGGACCAGCTGCCCCAGCCTGGGAGGGAAGCCCAAG
CTCTTTTTCATCCAGGCCTGTGGTGGGG
gtaagcagctcctcagcctccctctgggtgggtctggtggggagggagccgccacctgct
tctttctccagcctgcccctcacagggcccatgaggtctctccaggcagtcagagggtac
cacacatggtccctttttggcagcacctctgtctggctggagcaggccctgctctgtctg
EXON 7  180 bp
gcaggtttgcgtgacccagttcccagcttgacttttccgtttggcttaatgagtttgggg
tcccaagatttattttcctttcacactgttaatgtagtatattgcaccgactttcatatg
ttgaaccatccttgtctgtgtatttcaatgacaagaggtgtttgtttctgcttcctgcag
AGCAGAAAGACCATGGGTTTGAGGTGGCCTCCACTTCCCCTGAAGACGAGTCCCCTGGCA
GTAACCCCGAGCCAGATGCCACCCCGTTCCAGGAAGGTTTGAGGACCTTCGACCAGCTGG
ACGCCATATCTAGTTTGCCCACACCCAGTGACATCTTTGTGTCCTACTCTACTTTCCCAG

gtgagcacatcagaagggctcgtcctcgcagccagtgggtcttcccgtctgccctagagg
cagctgtgtggtgagagaaaagaccagggtatgagtcctggttctgtcttttgcccctct
gtgaccctgagcaagttacttctctctgagcctcggctcaggctgagcgggcaaggatgc
EXON 8  110 bp
catgagggtgaaataagatcatgattagggcagagcctcaggggccaggctgctcctgtt
ggatgtatgtatgagtcaaggtctggagggcgcccgagccagcgtgcatggccagagggg
tggtggggagccggcggaggggtggctctccagcagtgttcagccctcctccctccaaag
GTTTTGTTTCCTGGAGGGACCCCAAGAGTGGCTCCTGGTACGTTGAGACCCTGGACGACA
TCTTTGAGCAGTGGGCTCACTCTGAAGACCTGCAGTCCCTCCTGCTTAGG
gtgagtgctgccttcctctgcaaaggagaggggaggctgctgaggggcagcgtgtcctcc
tggggctggggatttggggtgagcagggcaggcccaaaccaagggtaaaaggtagtagac
tcctgcctctgagccttggagtcggcacttttgtgtctctttatgagaggcatcctgcct
EXON 9  740 bp
ttgagttttttaaaggtaaagttgaggtgcgtattctttaagccctcctgctcaaagagg
ctgcagtttgagctgtttttaaggtgcgggttgagtggacattccccccagcccctcttg
aattcttccttcagtccagagaactgaactcacagagctctccatggtcatgtcttacag
GTCGCTAATGCTGTTTCGGTGAAAGGGATTTATAAACAGATGCCTGGTTGCTTTAATTTC
CTCCGGAAAAAACTTTTCTTTAAAACATCATAAGGCCAGGGCCCCTCACCCTGCCTTATC
TTGCACCCCAAAGCTTTCCTGCCCCAGGCCTGAAAGAGGCTGAGGCCTGGACTTTCCTGC
AACTCAAGGACTTTGCAGCCGGCACAGGGTCTGCTCTTTCTCTGCCAGTGACAGACAGGC
TCTTAGCAGCTTCCAGATTGACGACAAGTGCTGAACAGTGGAGGAAGAGGGACAGATGAA
TGCCGTGGATTGCACGTGGCCTCTTGAGCAGTGGCTGGTCCAGGGCTAGTGACTTGTGTC
CCATGATCCCTGTGTTGTCTCTAGAGCAGGGATTAACCTCTGCACTACTGACATGTGGGG
CCAGGTCACCCTTTGCTGTGAGGCTGTCCTGTACATTGTGGGATGTTCAGCACTGTCCCT
TGCCTCAATGCCAGTAACGCGTCTTCCTGAGTGGTGCCAAACAAAAAGGTTCTCAGGTGT
TGCCAAATATGTCCTGGGGTATAAAACTTTCCTCGCCTGACAACCACTGGTCTGTAGGGA
TTTTTGGCTACACACAAACCAGTATCGCTCATAGATCAGCAAACCGGGGCCTACTAGAGT
CTGAACAGCTGTAATCTATGAATTCTAAGTGAAATTTTAAAAATTGTTAATTTTTCCTAT
ATTGCATTAATTTTAAAAAA
taaatctgaggcaaatatggactctcttttgcctatttcttccctcattttgctccaact
ctttcttcttccttacaaaagagacttttgcttttttcgaaacatttccccatgtttttc
tggggtctcgctatgttgcccaggctggtctcaaactcctgggctcaagtgaccctccca