Gene CASP9 Variant 1
DNA : 32.00 KbNT_004873
mRNA : 1543 bp NM_032996
CDS : 801 bp NP_127463
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  227 bp
gtgttctggggcggcgcggtgatgggaggcttggccctgggggcggggcgaggcgcagag
gtgcgtcctgagggcggggcggtgacgcaagagcgactcctgggggcggggcgaggcctt
ggagatgcgtccggaggcggtggggagcgaagactgacccggggccgtgacgcgggggca
GGCCCTGGGGCGGGGGCGGGTCCTGGGGACTGGGGCGGGCGGCCGAGGCCCGGAAGCGGA
CTGAGGCGGCCTGGAGTCTTAGTTGGCTACTCGCCATGGACGAAGCGGATCGGCGGCTCC
TGCGGCGGTGCCGGCTGCGGCTGGTGGAAGAGCTGCAGGTGGACCAGCTCTGGGACGCCC
TGCTGAGCCGCGAGCTGTTCAGGCCCCATATGATCGAGGACATCCAG
gtgcgcccccggccccctgtccccgcgctgcacggccgggtccccacgcccctcgaggag
gcgttgtgcgggagcctagccttccctgtggcttcaaacccctcagcggagccaaagaat
cccaaacacctcttagtcgggtgttcgctaaagcgattccatgccatactcagtcagcgt
EXON 2  286 bp
ccctgcaaaataatgaacagatcagcaaaggctggtaaatggcacacagtgcacctgcag
ctccattgctgcccacgtgcctgattgtttagacttacagtagctgggaaatggggagac
aaggtgagagccatataaaagtacgtggataattagtatcctgcctttctttccaaacag
CGGGCAGGCTCTGGATCTCGGCGGGATCAGGCCAGGCAGCTGATCATAGATCTGGAGACT
CGAGGGAGTCAGGCTCTTCCTTTGTTCATCTCCTGCTTAGAGGACACAGGCCAGGACATG
CTGGCTTCGTTTCTGCGAACTAACAGGCAAGCAGCAAAGTTGTCGAAGCCAACCCTAGAA
AACCTTACCCCAGTGGTGCTCAGACCAGAGATTCGCAAACCAGAGGTTCTCAGACCGGAA
ACACCCAGACCAGTGGACATTGGTTCTGGAGGATTTGGTGATGTCG
gtaagtagcaagagagtgattggtgggtgggcatgacacgtagtcatttgggactcacta
tgagtacagctgggtgggctgagattcagaatttaattttagcattgtctttctgaatgt
tcatagggatggcaaaattctgggaggttttcaggaggttgaatcttggcagcccctcct
EXON 3  180 bp
gcaggtttgcgtgacccagttcccagcttgacttttccgtttggcttaatgagtttgggg
tcccaagatttattttcctttcacactgttaatgtagtatattgcaccgactttcatatg
ttgaaccatccttgtctgtgtatttcaatgacaagaggtgtttgtttctgcttcctgcag
AGCAGAAAGACCATGGGTTTGAGGTGGCCTCCACTTCCCCTGAAGACGAGTCCCCTGGCA
GTAACCCCGAGCCAGATGCCACCCCGTTCCAGGAAGGTTTGAGGACCTTCGACCAGCTGG
ACGCCATATCTAGTTTGCCCACACCCAGTGACATCTTTGTGTCCTACTCTACTTTCCCAG

gtgagcacatcagaagggctcgtcctcgcagccagtgggtcttcccgtctgccctagagg
cagctgtgtggtgagagaaaagaccagggtatgagtcctggttctgtcttttgcccctct
gtgaccctgagcaagttacttctctctgagcctcggctcaggctgagcgggcaaggatgc
EXON 4  110 bp
catgagggtgaaataagatcatgattagggcagagcctcaggggccaggctgctcctgtt
ggatgtatgtatgagtcaaggtctggagggcgcccgagccagcgtgcatggccagagggg
tggtggggagccggcggaggggtggctctccagcagtgttcagccctcctccctccaaag
GTTTTGTTTCCTGGAGGGACCCCAAGAGTGGCTCCTGGTACGTTGAGACCCTGGACGACA
TCTTTGAGCAGTGGGCTCACTCTGAAGACCTGCAGTCCCTCCTGCTTAGG
gtgagtgctgccttcctctgcaaaggagaggggaggctgctgaggggcagcgtgtcctcc
tggggctggggatttggggtgagcagggcaggcccaaaccaagggtaaaaggtagtagac
tcctgcctctgagccttggagtcggcacttttgtgtctctttatgagaggcatcctgcct
EXON 5  740 bp
ttgagttttttaaaggtaaagttgaggtgcgtattctttaagccctcctgctcaaagagg
ctgcagtttgagctgtttttaaggtgcgggttgagtggacattccccccagcccctcttg
aattcttccttcagtccagagaactgaactcacagagctctccatggtcatgtcttacag
GTCGCTAATGCTGTTTCGGTGAAAGGGATTTATAAACAGATGCCTGGTTGCTTTAATTTC
CTCCGGAAAAAACTTTTCTTTAAAACATCATAAGGCCAGGGCCCCTCACCCTGCCTTATC
TTGCACCCCAAAGCTTTCCTGCCCCAGGCCTGAAAGAGGCTGAGGCCTGGACTTTCCTGC
AACTCAAGGACTTTGCAGCCGGCACAGGGTCTGCTCTTTCTCTGCCAGTGACAGACAGGC
TCTTAGCAGCTTCCAGATTGACGACAAGTGCTGAACAGTGGAGGAAGAGGGACAGATGAA
TGCCGTGGATTGCACGTGGCCTCTTGAGCAGTGGCTGGTCCAGGGCTAGTGACTTGTGTC
CCATGATCCCTGTGTTGTCTCTAGAGCAGGGATTAACCTCTGCACTACTGACATGTGGGG
CCAGGTCACCCTTTGCTGTGAGGCTGTCCTGTACATTGTGGGATGTTCAGCACTGTCCCT
TGCCTCAATGCCAGTAACGCGTCTTCCTGAGTGGTGCCAAACAAAAAGGTTCTCAGGTGT
TGCCAAATATGTCCTGGGGTATAAAACTTTCCTCGCCTGACAACCACTGGTCTGTAGGGA
TTTTTGGCTACACACAAACCAGTATCGCTCATAGATCAGCAAACCGGGGCCTACTAGAGT
CTGAACAGCTGTAATCTATGAATTCTAAGTGAAATTTTAAAAATTGTTAATTTTTCCTAT
ATTGCATTAATTTTAAAAAA
taaatctgaggcaaatatggactctcttttgcctatttcttccctcattttgctccaact
ctttcttcttccttacaaaagagacttttgcttttttcgaaacatttccccatgtttttc
tggggtctcgctatgttgcccaggctggtctcaaactcctgggctcaagtgaccctccca