Gene CAMTA1 Variant 1
DNA : 982.52 KbNT_021937
mRNA : 6581 bp XM_042323
CDS : 5022 bp XP_042323
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  252 bp
ggaaatattccgtgtcgggcccgtcctgattggacagttctttcgggttctggccactag
gaagctttgtttaggtccggaaggcgggctttcctgggagtgggtggggagggggcgttg
attcttgaccaatcctttcagtccgttgggtggtgaccagccaatgggccggatggatag
GACGCTCCTCCCGGAGAGTAGTGAGACCCCTGGTGCGGGGCGATTGGCGGCGGGAGCGAT
GAGTGGCAGCCGCACGGCCCAACGGGAGCTGTGCGTGGGCCGCGGGGCGGGGCCAGGGCG
GGTGCGCGGCGGCGGCGGGGTGGCTGGGCCGGCGGCGGCGGCGGTACGAGGCGCGCGCTC
GGGGTCCCGGTCGCGAGGAGGAGGAGGATGTGGCGCGCGGAGGGGAAATGGCTGCCGAAA
ACAAGCCGGAAG
gtaagagccggagcgcgaggggctggggggcggcgcggcgggcggcgggacccggccccg
ccggacatcccgggcatcggcggcgccgggcgggagcgcgggggcgcggcgggcgggcgg
gcgggcgacccggccggggagggggccggcggggtgggggggcggagcgcggccgagtcc
EXON 2  70 bp
gaccttgacactcttgaggattgcaggccagtcattttgtggaatgttccttgatttgga
tttgtctgatgtttcctcatgattagattcaggttttgcatcttggcaggaatatcacag
aagagccagattatatctttttgaaagattagttttacattttattttctgtttccttag
AGCGTTTCCCAAAGTGTATTCTGCGGAACTAGCACCTACTGTGTTCTCAACACCGTGCCA
CCTATAGAAG
gtaggatttgaaaaagcttttgacttacaggaaggggtgggcttggcagtggcagtaatt
atcatctagtacagtggaaacagccttcagcccggactcagaagacctgggttctgcact
taactgctgtgtgatcttagatgagttacttaatccttctggggtagcaaaaagaatgct
EXON 3  119 bp
tgctgccatcaatctgataaatgggtaaatgagtattattaactaagaggaatagtgggg
cctctgatgctcttggtctcacattgactaaactgagctgctatttctgactttgtcagt
gtactttaaaggagattttatctattattttctctaaatttattgttttcttctttgtag
ATGATCATGGGAACAGCAATAGTAGTCATGTAAAAATCTTTTTACCGAAAAAGCTGCTTG
AATGTCTGCCGAAATGTTCAAGTTTACCAAAAGAGAGGCACCGCTGGAACACTAATGAG
gtagataagtttctttttttaagggtataattattttaagggcaaattttttaggttgct
tcacatagtcctactttatgttagctttaaatttaaaatactgatctaggaaattgtaaa
tgacattatttaatctggatttgacagaaaccaaccaacatgttttttgatctgtctctg
EXON 4  68 bp
atggaaaggccttaaaaaatcaaaatagaaacagagtccaagtcgagtatttctctagca
gggatggagttccaggctcgcaaatgaaaacagcagctgggaaacagcaaaaactttctt
acctctcaggatccaatgtgagctaattgttgttattatctttttattcttctgtttcag
GAAATTGCAGCTTATTTAATAACATTTGAGAAACACGAAGAATGGCTAACCACCTCCCCT
AAGACAAG
gtaatgtcccagatcttgcagtttttcaaatgtgtaccataagtggattgatttgcattg
attacctgatttggccagtgaattcatgggcaacgagttgaaaatgccatgttgtgctgg
atggctttcgacactgaggtctcattcattgacataagactgtggcagtgaatacgatca
EXON 5  136 bp
ttttggctggccataaaacatggttaatccagggagatgcaataaaaggtgaaaaattat
gttccagcaaatgtggaatattgcttttctgtagagacttttactggtcgatgatatctt
tcttcataaatttttcttctacttggtactcttggtaacttaaccatttgttgtttccag
ACCACAGAATGGCTCAATGATACTCTACAACAGGAAGAAAGTGAAATACAGGAAAGATGG
GTATTGCTGGAAAAAGAGGAAAGATGGGAAAACGACCAGAGAGGACCACATGAAACTCAA
GGTCCAGGGAGTGGAG
gtaaacagcagaaaaggttcccttggtgcacaaatgtcatttgcaggctgcagtggagaa
tggaattgcttggagtaatttgatgcgagtcacctctgtccaaagaatttttgtttgcca
agaccctggtttttgcttttgtttcgtttttctaccttcttaccctatagtctccattca
EXON 6  72 bp
gtaggtgctgtcccagagccttagtcttggagctggagccagacgcagaggtgccctcgg
tctccctgggccgctgccaggcggctgtggccccttcttgctccttctctgttgcgccgt
cttccttccttccttccttccctctttccaactgaattctcgtttttcctctctccctag
TGCTTGTACGGCTGCTATGTCCATTCCTCCATCATCCCCACCTTCCACCGGAGGTGCTAC
TGGCTCCTTCAG
gtaggtggctgggactggattcttcttctgtctctggtgctcgggaagggtctgtggagg
gcactgagggcgcggggctccgcatgcgacacggcttcgggctgagagccctggtgagct
tgcctagggagacttcggctgttgcggcactgaggccagctcagtggctgggctggtgtt
EXON 7  154 bp
cacatgcgccggacagcccccaccacagaaccatctggctgcaaccgtcagcagtgtgag
gtcaagagagccgggtgtctggggcctcagtctctgcctgcacctgcggggttgggggcg
gccctgaccctggtgggctccatgccaccctcatgctgccagtctctgctctccccacag
AACCCCGACATCGTCCTGGTGCACTACCTGAACGTGCCGGCCATCGAGGACTGCGGCAAG
CCTTGCGGCCCCATCCTCTGCTCCATCAACACCGACAAGAAGGAGTGGGCGAAATGGACG
AAAGAAGAGCTCATCGGGCAGCTGAAACCCATGT
gtgagtggccttggccggcctggcgcccccacgctgggaaccaggctggcatcaaccagg
cggggccaggaaggtcctctgtggccttggggatgcgggtccggagccccatcttgctgg
aatgacagtggcaccgtgagcttagcttttgccccaccttcacttggccccttgtaagct
EXON 8  141 bp
cgggggcagcctggcctcccttcccctcctcctcccctactcatcaattcgccccaggag
ccagctccccagcagtgagagggctgccctcagggagggcctgggtcctaccccttggcc
ccacccaggtcccctctgcacccacgggctctgacagcccccctgcctctctcttcacag
TCCATGGCATCAAGTGGACCTGCAGCAATGGGAACAGCAGCTCAGGCTTCTCGGTGGAAC
AGCTGGTGCAGCAGATCCTCGACAGCCACCAGACCAAGCCCCAGCCGCGGACCCACAACT
GCCTCTGCACCGGCAGCCTGG
gtgagccggggctcccggggcaggcgggcgccacggggacagaggggccctaccaggcag
ccgtcatggctgtcctctgtgggagtagccatgacatctagtgagggaggagggggacag
tcagggactgggcgacaccaccgcacccagcacagacacaaggcaggccttccgcctcgt
EXON 9  1847 bp
gtccaagggctgagagtctgtggcctgcctggggtaccgggcctggactttgccagggac
cccagccgctgtggggcaggtccaccacggtcctagctctgactctcttttgtgtgtgca
tgtgtgtgtgcacatgtgtgcctgcgtgtgcgtgcgcgtgttgtgttccgatctccgcag
GAGCTGGCGGCAGCGTGCATCACAAGTGTAACAGCGCCAAACACCGCATCATCTCGCCCA
AGGTGGAGCCACGGACAGGGGGGTACGGGAGCCACTCGGAGGTGCAGCACAATGACGTGT
CGGAGGGCAAGCACGAGCACAGCCACAGCAAGGGCTCCAGCCGTGAGAAGAGGAACGGCA
AGGTGGCCAAGCCCGTGCTCCTGCACCAGAGCAGCACCGAGGTCTCCTCCACCAACCAGG
TGGAAGTCCCCGACACCACCCAGAGCTCCCCTGTGTCCATCAGCAGCGGGCTCAACAGCG
ACCCGGACATGGTGGACAGCCCGGTGGTCACAGGTGTGTCCGGTATGGCGGTGGCCTCTG
TGATGGGGAGCTTGTCCCAGAGCGCCACGGTGTTCATGTCAGAGGTCACCAATGAGGCCG
TGTACACCATGTCCCCCACCGCTGGCCCCAACCACCACCTCCTCTCACCTGACGCCTCTC
AGGGCCTCGTCCTGGCCGTGAGCTCTGATGGCCACAAGTTCGCCTTTCCCACCACGGGCA
GCTCGGAGAGCCTGTCCATGCTGCCCACCAACGTGTCCGAAGAGCTGGTCCTCTCCACCA
CCCTCGACGGTGGCCGGAAGATTCCAGAAACCACCATGAACTTTGACCCCGACTGTTTCC
TTAATAACCCAAAGCAGGGCCAGACGTACGGGGGTGGAGGCCTGAAAGCCGAGATGGTCA
GCTCCAACATCCGGCACTCGCCACCCGGGGAGCGGAGCTTCAGCTTTACCACCGTCCTCA
CCAAGGAGATCAAGACCGAGGACACCTCCTTCGAGCAGCAGATGGCCAAAGAAGCGTACT
CCTCCTCCGCGGCGGCTGTGGCAGCCAGCTCCCTCACCCTGACCGCCGGCTCCAGCCTCC
TGCCGTCGGGCGGCGGCCTGAGTCCCAGCACCACCCTGGAGCAGATGGACTTCAGCGCCA
TCGACTCCAACAAGGACTACACGTCCAGCTTCAGCCAGACGGGCCACAGCCCCCACATCC
ACCAGACCCCCTCCCCGAGCTTCTTCCTGCAGGACGCCAGCAAACCCCTCCCCGTCGAGC
AGAACACCCACAGCAGCCTGAGTGACTCTGGGGGCACCTTCGTGATGCCCACGGTGAAAA
CGGAGGCCTCGTCCCAAACCAGCTCCTGCAGCGGTCACGTGGAGACGCGGATCGAGTCCA
CTTCCTCCCTCCACCTCATGCAGTTCCAGGCCAACTTCCAGGCCATGACGGCAGAAGGGG
AGGTCACCATGGAGACCTCGCAGGCGGCGGAAGGGAGCGAGGTCCTGCTCAAGTCTGGGG
AGCTGCAGGCTTGCAGCTCTGAGCACTACCTGCAGCCGGAGACCAACGGGGTAATCCGAA
GCGCCGGCGGCGTCCCCATCCTCCCGGGCAACGTGGTGCAGGGACTCTACCCCGTGGCCC
AGCCCAGCCTCGGCAACGCCTCCAACATGGAGCTCAGCCTGGACCACTTTGACATCTCCT
TCAGCAACCAGTTCTCCGACCTGATCAACGACTTCATCTCCGTGGAGGGGGGCAGCAGCA
CCATCTATGGGCACCAGCTGGTGTCGGGGGACAGCACGGCGCTCTCACAGTCAGAGGACG
GGGCGCGGGCCCCCTTCACCCAGGCAGAGATGTGCCTCCCCTGCTGTAGCCCCCAGCAGG
GTAGCCTGCAGCTGAGCAGCTCGGAGGGCGGGGCCAGCACCATGGCCTACATGCACGTCG
CCGAGGTGGTCTCGGCCGCCTCGGCCCAGGGCACCCTAGGCATGCTGCAGCAGAGCGGAC
GGGTGTTCATGGTGACCGACTACTCCCCAGAGTGGTCTTACCCAGAG
gtaagctgccgccgctgccaccacctgtcacctcccctcccacccacctcgccagcccct
gcgccaccctgcagctaagggatgcctgtggctgcccttcagaggaagctctggaccaca
aagatgatgctttcccctccttgtgtccccacggcgcttgaacacctccgtctttcacgc
EXON 10  127 bp
tggagctgtggttctcagaagtcggggctcactgcaatccctggagtgagggcctgggaa
tctgcatggggcgaggggtacagacccccatctgagcagtgaagcctcaggggggcttcc
ccatgctgcctcccacagtggctcacactccaactctgttcccctctctgttctctgcag
GGAGGAGTGAAGGTCCTCATCACAGGCCCGTGGCAAGAAGCCAGCAATAACTACAGCTGC
CTGTTTGACCAGATCTCAGTGCCTGCATCCCTGATTCAGCCTGGGGTGCTGCGCTGCTAC
TGCCCAG
gtgagaaagccgccccccaggcccccaaggtgagtgtgatggcctgaggagcactggact
cggagttggccttggggtgaccttgagcaggtcatgtccttactctaggcctcagtttcc
tcggctgtgaagaagcggatccccgatagtctattagaacgtcacctcctttggctcagg
EXON 11  135 bp
aggttcctagaagcagcattgtgtttgggcctcgaatgagcaggcataggctaccattaa
ggagagctggacattaaccaatgaagggtagtggggaggggacattccaggccctgtgtg
gttcaccaggctgtaggtacccacccatcccttgacctggtctttttctctcgctttcag
CCCATGACACTGGTCTTGTGACCCTACAAGTTGCCTTCAACAACCAGATCATCTCCAACT
CGGTGGTGTTTGAGTACAAAGCCCGGGCTCTGCCCACGCTCCCTTCCTCCCAGCACGACT
GGCTGTCGTTGGACG
gtaagaacagtgcttgggtcgtcttgccaggcaccaagggagagggatgcttggggactc
ttgcacaaggtgtgaaagaagagtaagcacccagaaaggggcaggaagtggtgccaatgt
gagcaaaggaaggccgactgggtctccaccgccaggctgagtgcctatgctgtcagccat
EXON 12  152 bp
cctgtgtgaggtggtgacagattcacgatcgtgctggggaactctggctggcggagacct
ctctggtttggtgaagttacggacggcatttggatgctggtcccgcaaggctggcgaggc
cacgtgttgactgcttttcttccagaacacaacctcactcttcctcctgctctgccctag
ATAACCAGTTCAGGATGTCCATCCTGGAACGACTGGAGCAGATGGAGAGGAGGATGGCCG
AGATGACGGGGTCCCAGCAGCACAAACAGGCGAGCGGAGGCGGCAGCAGTGGAGGCGGCA
GCGGGAGCGGGAATGGAGGGAGCCAGGCACAG
gtacgaggcggtgctgatgctcagctcccatttcgcttcatgtttatggattggcgaggc
agtggatggatcacaggcctcttctctgctgctgatgcggtccctgtattcaggcagaag
gcctgagggagtactttacggtacctgtgcttttaagcattataatctgtgcagtatgga
EXON 13  197 bp
caaagtgctaggatttcaggcatgatccagcatgcccagccaatgtttctttattttcag
tgttttatgttttccgttgtgagtttctaatcgtaaagcatttgtttcccctacatcgaa
gcgctgatggggtcgagggcctttagtcctgaggtcgtaacgtgcgcttttttgtgacag
TGTGCTTCTGGGACTGGGGCCTTGGGGAGCTGCTTTGAGAGCCGTGTGGTCGTGGTATGC
GAGAAGATGATGAGCCGAGCCTGCTGGGCGAAGTCCAAGCACTTGATCCACTCAAAGACT
TTCCGCGGAATGACCCTACTCCACCTGGCCGCTGCCCAGGGCTATGCCACCCTAATCCAG
ACCCTCATCAAATGGCG
gtaaggctgtggtgcagctggctgggggtcagcctcgcacatcctcgctcacattcttcc
tgagcactgccacccgtggaagaaatctacccattcagtccactttatagccggcgagca
aagggctttgtccttggacagtttccaagggagttttataaacttcttcccaagaaatac
EXON 14  79 bp
gtcattttctttggacccctagccaaatggagcgtccacactgccctgggactctgtttc
ttcaccatggggatgttatatacccagttgggtttcatcttggtggggttttataatatt
ctggtgtttccttttaacggtggtgaatagtgtggtaatttctggtgctctcccttatag
TACAAAGCACGCGGATAGCATTGACCTGGAACTGGAAGTTGACCCCTTGAATGTGGACCA
CTTCTCCTGTACTCCTCTG
gtaaggaatggattcctgtagcccccccttgctgttcttccagtctggcataggatttgc
ctggttcccaccgttgtctcttgctgacacatggcatgtttcggagatactttgggatgg
gaatcttcaatggccccaccgagattgccagcaaggaccagtttgtcagttggcagcaat
EXON 15  316 bp
tcccaccgttgtctcttgctgacacatggcatgtttcggagatactttgggatgggaatc
ttcaatggccccaccgagattgccagcaaggaccagtttgtcagttggcagcaatggcaa
aagtcaggtctggtcttgacctctgattgagaacgcttgctgtgtctccctgtcttctag
ATGTGGGCGTGTGCCCTAGGGCACTTGGAAGCTGCCGTCGTGCTGTACAAGTGGGACCGT
CGGGCCATCTCGATTCCCGACTCTCTAGGAAGGCTGCCTTTGGGAATTGCCAGGTCACGG
GGTCATGTGAAATTAGCAGAGTGTCTGGAGCACCTGCAGAGAGATGAGCAGGCTCAGCTG
GGACAGAACCCCAGAATCCACTGTCCTGCAAGCGAAGAGCCCAGCACAGAGAGCTGGATG
GCCCAGTGGCACAGCGAAGCCATCAGCTCTCCAGAAATACCCAAGGGAGTCACTGTTATT
GCAAGCACCAACCCAG
gtaagaattcagaatcatgacatctcagagcttgacagagatcccgtttgctttcatgca
gctgccctcagcagagtccataggatagtcacatacatttcagtttttttgttaatgttt
ctgatttttctttaagaatgcctagtgctgccccctcccccagtacagaagaaagtagca
EXON 16  524 bp
taattttggaggaggaagatctgaatctggtgtatgctactggggatatttaaatgttag
ggacgtgtcttgagttccggctttgcactttgtgtctctcaggcatagagaaagtgttga
ttcttgaggattcctagttgtatctcctgtcctgactatcctttctactgtacttttcag
AGCTGAGAAGACCTCGTTCTGAACCCTCTAATTACTACAGCAGTGAGAGCCACAAAGATT
ATCCGGCTCCCAAAAAGCATAAATTGAACCCTGAGTACTTCCAGACAAGGCAGGAGAAGC
TGCTTCCCACTGCACTGAGTCTGGAAGAGCCAAATATCAGGAAGCAAAGCCCTAGTTCTA
AGCAGTCTGTCCCCGAGACACTCAGCCCCAGTGAAGGAGTGAGGGACTTCAGCCGGGAAC
TCTCCCCTCCCACTCCAGAGACTGCAGCATTTCAAGCCTCTGGATCTCAGCCTGTAGGAA
AGTGGAATTCCAAAGATCTTTACATTGGTGTGTCTACAGTACAGGTGACTGGAAATCCGA
AGGGGACCAGTGTAGGAAAGGAGGCAGCACCTTCACAGGTGCGTCCACGGGAACCAATGA
GTGTCCTGATGATGGCTAACAGAGAGGTGGTGAATACAGAGCTGGGGTCCTACCGTGATA
GTGCAGAAAATGAAGAATGCGGCCAGCCCATGGATGACATACAG
gtaaaaagcagggacagggtaagcccgcagaggctggtgcgttccagttgctgtgatctt
tatggtccatttccgaaggttgtgtcattttcctccccgtgaagccttcgaagttggctt
tgtgcagaacatcgttggagtatcttctttccttggggccacattttcattcggtgaatc
EXON 17  188 bp
agcacattttggtgtgttatgttataaccttaaaatggtatttcattgcattggattgag
gtggaagtctgccctcctgcctgattatttttttctctccaaggcgaggcagggaggtag
acctggataacttgtaaggttcctttctaacctgagtgttctgtgaacttctgacttcag
GTGAACATGATGACCTTGGCAGAACACATTATTGAAGCCACACCTGACCGAATCAAGCAG
GAGAATTTTGTGCCCATGGAGTCCTCAGGATTGGAAAGAACAGACCCTGCCACCATTAGC
AGTACAATGAGCTGGCTGGCCAGTTATCTAGCGGATGCTGACTGCCTTCCCAGTGCTGCC
CAGATCCG
gtgagtaaagttacggaggtcactacccagcatagattcccggatgtaattggaggcagg
ggaggctgattgtatttgatgaatgccgtgtcatagaagaccataccaaggaaggaagga
agcatgaggacaagctctgttgccactttcaaggcccagctcctattcctacctctccca
EXON 18  247 bp
taaacttactcaatcgaaggacactgggtatgtttagcaacttgcctaactgaatgaagg
catgttcctaattgcccacagtggcttctggcagataccatcttggctcattcattaata
tctaatgggtggtgcaaatcaatcattaatctgtctctcctttttctcctcttgtttcag
AAGTGCATATAACGAGCCTCTAACCCCTTCTTCTAATACCAGCTTGAGCCCTGTTGGCTC
TCCCGTCAGTGAAATCGCTTTCGAGAAACCTAACCTTCCCTCCGCCGCGGATTGGTCAGA
ATTCCTGAGTGCATCTACCAGTGAGAAGGTAGAGAATGAGTTTGCTCAGCTCACTCTGTC
TGATCATGAACAGAGAGAACTCTATGAGGCTGCCAGGCTTGTCCAGACAGCTTTCCGGAA
ATACAAG
gtaaactagaacagaaccttcgttttgtgacattcttaagatcagagaggacagatgaaa
gtcagaatcatgcgaacaaaaacatttactatttctttttttcctctgaatttgtagaat
ttttttggaagtctccaatttattaagattcactatataacatatctgtgtgtgtatctg
EXON 19  72 bp
ggatagtctaaggtttattctataaattcatttttcctcatttataattaattatcaata
ttttttggtaaacctgggatctcaactctgagaaggtgcattaaatgagtagtaataaaa
agctgacatttctggtagttaatcattactgattttttttctccttactttacccttaag
GGCCGACCCTTGCGGGAACAGCAAGAAGTAGCTGCTGCTGTTATTCAGCGTTGTTACAGA
AAATATAAACAG
gtaaacctcagttttgcaccacagaaggaaactgtgccccacccaaggccactgaagatc
ctggtttggctaaagagcactacatctagtacctcattacagagacttaatttgtttttt
ggttgtttttttttttttattttttttttgaaacggagtctggctgtgtcgcccaggctg
EXON 20  194 bp
tttggaaaggtaggtgtaaagattcctcatttgcctcttttgtgattaaaccccggacag
agaatgtgataatagaggggaaaagcattttctcttcttcccttcccggtaagctcgaag
gacgctgagcccgtgcagcccctgttgttactgtgtcgcttgttcttgtttcccctgcag
TACGCACTTTATAAAAAGATGACACAGGCTGCCATCCTTATCCAGAGCAAATTCCGAAGT
TACTATGAACAAAAAAAATTCCAGCAGAGCCGACGGGCTGCTGTGCTCATCCAAAAGTAC
TACCGAAGTTATAAGAAATGTGGCAAAAGACGGCAGGCTCGCCGGACGGCTGTGATTGTA
CAACAGAAACTCAG
gtgggtggagaagagctcatggaggtaaagctccctagggaagagaactctgacttcttt
gaaagacttgtcctgggctgacattggagtctggggtgggcctaaagcattggcagtcac
tgtgttccagaacgttttaggcatggtggctgataagtacacctgtgctgagtctggttt
EXON 21  75 bp
tcgatactatgggaacagcatacgcactcatcccccttcagattgtatacatctttaaca
tatgctgttggctttgctacacgaactgcttaattcagagtcctctgtcactgctgacca
gttttccatattgggctttactgtaaccttcttgtgacaataatattctgactttttcag
GAGCAGTTTGCTAACCAAAAAGCAGGATCAAGCTGCTCGAAAAATAATGAGGTTTCTTCG
CCGCTGTCGCCACAG
gtacactagtccttgtttatacattctgctcagggagaatgatgaagcaaccctgacctt
cttaaccctcactaactcctatgtaaagctaatccccctgcagataatcagggcagacgt
cccaaattacaatagggcggtagagctctttaactagggatcaggttgctacccttggag
EXON 22  31 bp
cttaaattgatgaatttttttacctactcatttcacgtaccccaccatcactctcctttt
ctttctttccaaaaaagaaaccatgttatattcttttttgttgaaataaagctatttgta
agatttctgttgtgaccctcatgtgctaatagctctctggtgttgttttactgtctaaag
CCCCCTGGTGGACCATAGGCTGTACAAAAGG
gtgagtttagctgcctgctagccagtttctcttctcttccattttcagtattttgctttt
tgcttgcttgcatgaggctgcagcctaggtatgccagtaagtttcacatccattttgaat
gaattaaaatcaagtaaaaactaaccctaattactaacactgctattttatatgacagga
EXON 23  1385 bp
acgtctttcctttgaatattttccccaacaatttcacaggagtttcttttgccgtcaatc
ctcaaaacggttttagtcttggcttttcagttcagagggagtggtaatacccctttcctt
tacttggtcacaattcactatagagttatcgcctgctgttttgttttgtttctcttccag
AGTGAAAGAATTGAAAAAGGCCAAGGAACTTGAAGACATACAGCAGCATCCCTTAGCAAT
GTGACATTGCTTTTCAGACTGTTTTCATTTCTGTTTTTAGCAGAGACATGCAACAACAAC
ACACACGCACACACGCACACACACACACGTACACACACATACAAAATCCCTCTGCAGTTT
TGGGGAGATCAGCTGCAGGATTTTAACAGGAATGTTTTGGTCATTGCATTTGCACTTTCA
TGGACAACTTTTAATTTGATCAGCAAGACATCTTGGAACTCAATCTTCTGTTGGATCACG
GGAAATCAAGACACCCAGGAGGAATTGAAAGAGGCTTCCTCTTCTCAGGAAGAAGCCATT
TCCTTCTCATATAGGGCTGTATTCAAACATCGTGTGGAACTGTACAAATATTTATACCAA
AAATATAGATAAGAAAAGGTGGGGCTATACTAGCAACAAAAAAAGAATGCTGTTCCTGCA
CCTGCCGGTTATTTCCAAGAAGCTGAATCTTTGGGACTGATTCTCAGTGGAGGGCTTAGA
TCATACAAAAATCTTTATTGGGTCCGTGTGTTCTCATTTCCTTCACTGTTTATTTTTGTT
TGTTTGTTTGTTTGTTTTAATCTCTACAGCACATTTAATGCAACTTTTGAAATCTGCAGG
TTTTTAATGTCTTGTGGAAATTTGCAGAGGGGCAGGTGTGTGGTAAACGGGTAATGCATG
GGAAATAATGAGAAGCAGCTCACAGAGTTTAAACTATTTTCTTGTCCCCACCACCTTCCA
AGAACCTGCGAGGGTAGTAATCATCTTGTCCCCTTTTTCATGTTCAGCACTTTAATTTTT
TTGCCTTACTTTCATGTGCAATGAGAATTACTTAAGAATTGGTAACGCATGTAGCCTTTT
TTAGTAACCTTGGAAGCTGTAGTAATTCTAAGGAATCATGAACCTTGCCTGGACATTTGC
CACCTAAACGATCAGTGTGGTGCTGCGTTCTGGCCAGTAAATTCCATGTTTTTGGCTATA
TCTCATCCAAACTGAGCAGTTTCTGTGTATATATAGAAGGTAGAAATGAAAAGTGAGAAA
ATATTTGAAAGGGATTATATTAATTGCTAAATATTTTATTCACAAAGGTCAATAACATGG
CAAGATAAAATTATTTGTATAGTTTTGTCTGAATGAGCGAGAAAAATGTGGATGTACTGT
TTGTATATATTGTATATATTAAAACAGAGATATGTGCATGAAATCAAGAAAAAAGAAATG
AACAAAAGCAAAGCATTAGTGGCTATGGTCTGTAAAATGAAACAAAAAAACTTTATTTCA
CTATAAGAGTACTTTATTTTAAATGTTCTTTAGGAGAACATTTTGCTAAAGCATGACTAA
ACTGC
aaaaaaaaaaaaagagctactgtatttagacttaggaaaaaaggcagagtaacattactt
aaaaaaaaaaggatatgtttacatttaattttggctaccaggagtttagtttattttatt
taaaatttttttgccaatggtgccaagtaatgtgaatgctaatactgcttaagaaaatta