Gene CACNA1S Variant 1
DNA : 73.05 KbNT_004671
mRNA : 6166 bp NM_000069
CDS : 5622 bp NP_000060
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  379 bp
tcctgacctctgttgccccaggcttgaaaccttccatcctgtctccctctcccactgccc
ctgccccatcccaggcctgtgtgtaagttcttcccccgacccaccccaccctcctcaggg
gacagattgggaagtcactggctgggctgggtggaatgacagctgcctggcctcagaagc
TCAGGCCCGGCAGCGGGGAGCCGAGTGGAGGCTAATTTTACTTGCTGGGAGCGAGGAGAG
TAATCCTCCTGCCCCCACTCCTGCCCCCGCCCCCTGGCTGGCTCAGCAGGGCAGGCTCAG
CCGACAGCCTCAGCCAGCCTAGTCCCCAAGGCGGGGGCATTGGGGACACAGGGAAGGGAA
AGCACTGGGGTGGGGGAGCAGGAGAAAGCCAGATTCCCAGGGAAGCCATGGAGCCATCCT
CACCCCAGGATGAAGGCCTGAGGAAGAAACAGCCCAAGAAGCCAGTTCCTGAGATTCTGC
CAAGGCCACCCCGGGCCTTGTTCTGCCTGACCCTGGAGAACCCCCTGAGGAAGGCCTGCA
TCAGCATTGTAGAATGGAA
gtatccttcagggcccgggccgtgggggggggtgtgcgtcatgagggagggattcggggt
gatcacagagcacaaacttcctacaggagggccagggaggcctggcacttagacatgggg
tgaactcacagaattgagtgaggagctgggggaaggagccctcggctaagcaggagagga
EXON 2  106 bp
acctggtcctcactgtaccctgcaggggctcagggaaggagcagcgtgggcgagcgtcca
tgagcctgtccagcagcctggcatcagagtcacagtccagactgaccctcagcgccctca
tccccttaaccctgtaagtcccttgcctcactcgagggctctccttaaccctggctccag
GCCCTTCGAGACGATCATCTTGCTCACCATCTTTGCCAATTGTGTGGCCCTGGCCGTGTA
CCTGCCCATGCCGGAAGATGACAACAACTCTCTGAACCTCGGCCTG
gtaagattggcccttccatctcccttcctgcgagcctgcagccccaggcttggggaggcc
cccttggtggactctgttctgggggatggtgccggtggttcaactccctgacgatgcagg
ccctgcatccccagccacctgcagggctggctgagtggctcaatgggtttccagggtcaa
EXON 3  140 bp
gtggcagtgtgggggcatgtaggtgtggagtgggggggtaggcattccatcagcaagtgc
aaacgtcctgaggtgggcgtgcctgagcaacagcagggaacccagcacggctgcagggaa
gagagcaagggtgcactcagagagcacagaggcatgctgtgaccacgtttgctcccacag
GAGAAGCTGGAGTATTTCTTCCTCATTGTCTTCTCGATTGAAGCCGCCATGAAGATCATT
GCCTACGGCTTCTTATTCCACCAGGACGCTTACCTGCGCAGTGGCTGGAATGTGCTGGAC
TTCACCATTGTCTTCCTGGG
gtgagagctgggtgtggggagactgaaggtcagaccctcgctgaggactgtgtgcccact
gccaccaccaccagcatcttagaggtggggtgggactccagcattgtgctaaccactgca
tggagcagcctctgttagaggccggcccagcaagggagctgtccatgttggtggagagtg
EXON 4  143 bp
agtgaaattccccagataagcatgatcagatcatttgttagttgatgcacccgtatttgc
cgtctctcccctaggcctttccacaggtgctcaagcatggacaggacacagggcctcaga
ccactggggcagtggcttttccaacccctggaccccctctctccctcttctccattctag
GGTCTTCACCGTGATTCTGGAACAGGTTAACGTCATCCAAAGCCACACAGCCCCAATGAG
CAGCAAAGGAGCCGGCTTGGATGTCAAGGCCCTCAGAGCCTTCCGAGTGCTCAGACCCCT
CCGGCTGGTGTCGGGGGTGCCTA
gtgggtggcagtgtccctgcagacccctttctcctctcccttcctgttcccttgtccccc
agttctgggtccccttcctaccttgacatctcaggggcttcccaggatttatagggaggg
agggccaagagaccaagcagaggcgactcctcttttcccttccctgcctgcctctgcagg
EXON 5  153 bp
agtgggtggcagtgtccctgcagacccctttctcctctcccttcctgttcccttgtcccc
cagttctgggtccccttcctaccttgacatctcaggggcttcccaggatttatagggagg
gagggccaagagaccaagcagaggcgactcctcttttcccttccctgcctgcctctgcag
GCCTGCAGGTGGTCCTGAACTCCATCTTCAAGGCCATGCTCCCCCTCTTTCACATCGCCC
TGCTGGTCCTCTTTATGGTCATCATCTATGCCATCATCGGGCTGGAGCTCTTCAAGGGCA
AGATGCACAAGACCTGCTACTTCATTGGTACAG
gtgagctcccagggaaagtggggctgtggggcagggcctaggatggctcagaagggggag
ccaccctacctggtgaaggagcccggagctcagccattgccgcccacatctgttgacctt
gagaatgggtttctcctggataagggggacttggaggaagggcagctctactggagtcag
EXON 6  206 bp
agcccaaggcattcctcttcactgtcaccgtctgctccatgtgaagctgtcttttgcatt
ttcagcagagtgtctttagacttactgctcaattctcttaaattgctcttatacaccttt
cctcctgtcgttgtccacctactactgttgtctgatgttccctttgccttctgcctccag
ATATCGTGGCCACGGTGGAGAATGAAGAGCCATCGCCCTGCGCCAGGACGGGCTCAGGGC
GCCGGTGCACCATCAATGGCAGTGAGTGCCGGGGCGGCTGGCCAGGGCCCAACCATGGCA
TCACCCACTTCGACAACTTCGGCTTCTCCATGCTCACCGTGTACCAGTGCATTACCATGG
AGGGATGGACTGACGTCCTTTACTGG
gtgggtctgggcccgcgcctgcagaaccatctcccttcatccacaggcttgcaagggagt
ggggagggagggcttgccagtccacacaggaggccagtctctgacttgcgtgaccacagc
tccctcttgctcctccctggggaatctatacaggatgtgtgtccctttctggttcccagg
EXON 7  104 bp
ctagtcctcaggctggaaaagttcttccagactagtcctcaggttaggaaaaatgtcccc
tcaatatcccagcgtggcttctctccttgtcccccagggttgggtggagtcttaatgagc
agacttggggaagaggaaccaagccctcaactcagaggatcacacttctgtcctgaccag
GTCAATGATGCCATCGGGAATGAGTGGCCCTGGATCTATTTTGTCACCCTCATTTTGCTG
GGATCCTTCTTCATCCTCAACCTGGTGCTGGGTGTCCTGAGTGG
gtaagaaattcaaaggtagccaggggagaaaagagaaagaggaggaggggagaaggagga
ggaaggaaaaggaacggagggaaaagaaacaggaggggtggggggcgagtggagaggagg
aggagagaagggaggaggaggaaggagtggagcagggcagggggctgtgagtcaggccct
EXON 8  146 bp
aagtgagaggggctgtctctcagccaccttgaggggcacctggaccccaggcaacacccc
ggggccagaaaaaggagcgctccagtcacagaatgggcttgtctgtcctcaggaagctca
gtctttccttgacactgttccctcttctcctcctctcctggctcccccatctcatttcag
GGAATTCACCAAGGAGCGGGAGAAGGCCAAGTCCAGGGGAACCTTCCAGAAGCTCCGGGA
GAAGCAGCAACTAGATGAGGACCTTCGGGGCTACATGAGCTGGATCACGCAGGGCGAGGT
CATGGATGTTGAGGACTTCAGAGAAG
gtttgggcccaaaggctgtggtcagcactcaccccactctctcactcccacctctgagtc
ataccttgcaatcaggcccactgagcaagtccaacattagtcctttgagggtgagtgact
tgcctaaagcaaaatggctcaaaatggtaagatccaggtgtgaccagagctcttcccaaa
EXON 9  82 bp
tgggctctttagctcttggaactctcagtctctggaaagcacgaagcaatccaggcctac
ctaggacccattgttgcagatgtctctggtcaatgggcccttgtctcgggtgcccagtcc
aggtgtgtccagcccagaggggccccgaaggctggctgactctttctctcctgtctccag
GAAAACTGTCTTTGGATGAAGGTGGCTCTGACACAGAGAGCCTGTATGAAATTGCAGGCT
TGAACAAAATCATCCAGTTCAT
gtgagtatctgcccactgccccaggaacccccaacccccagctccctgagacatgagggt
agagtccagttacttcccctcagtggtttcagagtcacttgtctaatcctttagaaaggc
agcctttttaagaaaatagggccagttcctgctctgagggactccgcagggaccagatcc
EXON 10  161 bp
tgaaagatggaggattttactcagtctggctccctagctcatgccctgagcttctctcat
gtggctggcggaagtggggtggtcaggctacgcatgcctggagtttgtctgaaggtagct
tggacaggtggggcgtagaacagcacagcactgtagaccatcctctgtcccctccctcag
CCGACATTGGAGGCAGTGGAACCGCATCTTTCGCTGGAAGTGCCATGACATCGTGAAGTC
CAAGGTCTTCTATTGGCTGGTGATTCTCATCGTTGCCCTCAACACCCTGTCTATCGCCTC
AGAGCACCACAACCAGCCTCTCTGGCTGACCCGTTTGCAAG
gtgaggcggaacggagtgaagccgggaggagggcacatgtggctgtggcttgatgtcaaa
atcagccaatggcaccacaggttgtgcagaagaggtcaattagatattgacatcattttt
ctaaaaattatggaccatgagtgctggattatatgacctaatcagctcctttcacggggg
EXON 11  226 bp
gtgccacttcactccagtctgggcagagtgaggccctgccccctgcacccccaaaaaaca
tccatggtgccttggaaacaagggaaggggcgtcctgggttgaggcccagccacagccaa
ggctgggagtcaggagaagggaaggagagtgatgccggggctgtgccaccaaccctacag
ACATTGCCAACCGGGTGCTGCTGTCCCTCTTCACCACTGAGATGCTGATGAAGATGTACG
GGCTGGGCCTGCGCCAGTACTTCATGTCTATCTTCAACCGCTTCGACTGCTTCGTGGTGT
GTAGCGGTATCCTGGAGATCCTGCTGGTGGAGTCGGGTGCCATGACACCCCTGGGCATCT
CCGTGCTCCGCTGCATCCGCCTCCTGAGGATCTTCAAGATCACCAA
gtgagtgccggggtcggctggcactcccgggtccccggcaggcaccacgggctggtctgg
tctacacccatctcatttcctgaggtctgggatctgtgcaggttcaccactggtcccttg
cccagacttccctccctccttgaaataacctccttctgtgaaaaaagaatcacttcccca
EXON 12  208 bp
gtgctctgcaggaaggagagagtgggcatgcagccatgaatccagggtcttccagcagtg
aggcagccccctccctctgtgtcacatcagtcctgagtctttcccccaagcctgtccaca
cctcgtgggccccagtgagagggtctgtctcctcccaccttgtgcctcctcttccttcag
ATATTGGACGTCGCTGAGCAACCTGGTGGCATCCCTGCTCAACTCCATCCGCTCCATCGC
CTCCCTGCTGCTGCTGCTCTTCCTCTTCATCGTCATCTTCGCCCTCCTGGGCATGCAGCT
CTTTGGGGGGAGGTATGACTTTGAAGACACAGAAGTACGGCGCAGCAACTTTGACAACTT
TCCCCAAGCCCTCATCAGCGTCTTCCAG
gtaggctctccctctgcgtgtccctccttctgaacggttgctgaatcctgcttcttgtcc
ttcaagatcaaggtgggcatcaccttctccaggaagccttgtctgatctgctggttgagt
gcaatgtccttctctgggctcccctatcacctgtgcttctctccattgtaacacttgctt
EXON 13  121 bp
ttccccagctggaataggggttttggggatagcaggggctggccacccagactgtggaat
gaaaagagggaaggtctgagagaaccacagagttggaggagaacttcggtcaatgcggtc
ccaatagaagactctcaggcccctctgtgttcccgagccctctatcctccctccatacag
GTACTGACAGGGGAAGACTGGACCTCAATGATGTACAATGGGATCATGGCCTACGGCGGG
CCGTCCTACCCTGGCATGCTTGTGTGCATTTACTTCATCATCCTTTTCGTCTGTGGCAAC
T
gtatcctctcgggagcagggtgcagaaaagagcttagggagggggtgggggaaagggctt
aaaatgggggtcaagggtgtccagtttctaggtagccaggccctctggctggaggggagc
tcccaggcccatgcggtagggggtaggacatagcaaatgcaggtacagctgtaggataat
EXON 14  115 bp
ggtactctcagcaggcaggcttccctgagggccttccactatgtccctggatccacacct
tcccatgggtagctctgggagagtggggttaggtcctgcccacatgcaggcagacagaac
tcctgccctgcaggctcccttccacctacaaccaaaggctccttagctaaacccgctcag
ACATCCTGCTCAATGTCTTCCTGGCCATTGCCGTGGACAACCTGGCCGAGGCGGAGAGCC
TGACTTCTGCCCAGAAGGCCAAGGCTGAGGAGAAAAAACGCAGGAAGATGTCCAA
gtgagtgcttccttagcaggaagggacctggagtgctcagtcgtggccatggccttccag
ctctggacagggcctccctgtaacccaatgatcagggtccctgacatggtgacacccacc
tcagtgggcaaacttctgtaacctgcacatgggggtggctgagatccttccctgggggca
EXON 15  94 bp
ctctcaccacagagaagggacttgcctgagcccactgcccttcccatttgggggctgatg
ccactcctcctacagatcccctggagcccttggtgtgggatcctcctgaaggtgttgtca
ggttcagcagatccctgagaactttctggtttggcttccactttgggttttctaactcag
GGGTCTCCCAGACAAGTCAGAAGAGGAGAAGTCAACGATGGCCAAGAAGCTGGAGCAGAA
ACCCAAGGGTGAGGGCATCCCCACCACTGCCAAG
gtgagcacctcaggtggggatgttagaggcagtctaggggctcttccaatccatggttcc
cttcataccacagggtacaggtggggtagggtggggaggtaggagagttatcagccaggt
gagggcatctccctgcgtacgactggagggagagccagcgaatccatctccagggactcc
EXON 16  70 bp
ctggccttgctgggcctggcctctcatttgtaaaatggggatgatcataatattccctgt
tccttaggctgtagggatgattaagtgagctgaacgctaacaggctctccagtatatgct
cattgaggggaaaccgcaacttctttttcattgttatagtcattgtgttccttcctacag
CTGAAAATCGATGAGTTTGAATCTAATGTCAATGAGGTGAAGGATCCCTACCCCTCAGCC
GACTTCCCAG
gtgaggatgctggagactggactggagcagggtgctggggtgaagtaggggtgtgccggt
cctgaattctccccatgggcagtctcttgtgtgtccctacctgtacccctccatgtggag
atcagaacaccggagacatcccttctgtgcaaataagccatctgccagcttgtctctctc
EXON 17  133 bp
ctcactgtgaagagaaggagatgcccgggctggactctgccaaagccctagggtcccaag
tcagcctggtggtcccttgcttactggctgcaggggctcctaggagggctctgagcacag
aagccatgggcatagcaaagcatgggaagacacccctaattcctctctctctccccacag
GGGATGACGAGGAAGATGAGCCTGAGATCCCGCTGAGCCCCCGACCACGTCCCCTGGCTG
AGCTGCAGCTGAAAGAGAAGGCCGTGCCCATTCCAGAAGCCAGCTCCTTCTTCATCTTCA
GCCCCACCAATAA
gtgggtgccccttggctgctgtgggggtgattgatgcggctctcatctgcttccctgccc
tagaaaaaaccctgtctgactctccatgcctacagttatactatgagaaactcagtgttt
tagcttaagatcttgtgccctgtttaaaatgctagtatatctgggaaaagtaatgcttta
EXON 18  130 bp
gagaggtcagggccccctgtgtgtccagccagaggaccctgcaggtgcagggctgcactt
ctctcctggccagggaggagcaggaggtgtattccatgttcgtccgcaggatggaggctg
atgaggcctgagcctccagcagctcacagctcccctgccctccctacctcgccccaccag
GATCCGTGTCCTGTGTCACCGCATCGTCAATGCCACCTGGTTTACCAACTTCATCCTGCT
CTTCATCCTGCTCAGCAGCGCTGCACTGGCTGCGGAAGACCCCATCCGGGCTGATTCCAT
GAGAAATCAG
gtgacgggcttcaccctctctgccactcagcacccctgccccctccagcctcagtctggt
gcccagggttcagctgtatcctctatgtggctacaagcatcagagtttcttagagttcag
ttcctcagggataggactgcccactccactccttctgaacggcacaggctggggcacaga
EXON 19  60 bp
agcatcagagtttcttagagttcagttcctcagggataggactgcccactccactccttc
tgaacggcacaggctggggcacagaatggctctgactgcctgctttatgctgctgctgct
gctgatactgttgccccctcctcctctcactggctgctcccgcccctgccctgtccccag
ATCCTTAAACACTTTGACATCGGGTTCACCTCTGTCTTCACTGTGGAGATTGTCCTCAAG

gtgagtgaaggctgtggggcagccctggggagggagtttccctgatgtggctccagttta
cacacactgaactcaggggctggagagaagcagaaaagaggtggagactggcaggaaaga
ctcatgggacccagcacaccggcaggcccacaagtatctggatggagggctggaaagtaa
EXON 20  107 bp
gcgagcagagataggaaatgcatttaggccactgcaaggagttgagtgaaatatagagat
ttctggaaggctattgcctcagtaagtgctctcctgagcagaggcgagaagcccttgtct
gtgggagacaggcctgttctccaagctcctccatccaggctgctgcctctttctccccag
ATGACGACCTACGGAGCCTTCCTGCACAAGGGTTCCTTCTGCCGCAATTACTTCAACATG
CTGGACCTGCTGGTGGTGGCCGTGTCCCTCATCTCCATGGGACTTGA
gtgagcagcggcaagggccagccctgggcacagaccaccctctgctctgtgccagggctt
tgtagtgggagtcccacccatgttggtgggcccctgccacaagaggagggtctctcgggg
cctccgatggaggcagggggtcctgtgggttgtcaccagctggaatgtgggttgccacca
EXON 21  88 bp
tggctgtgccctggagtcgggcacactctcacggctggaggaaagggaaggggaaggtgg
gagtgttttcaggcagaaaggcagctggtgtggagggcaggatatggctggaggctccac
cgcagactgggctggctggagcaggctgccctcagccccctcaccattgccgccccccag
GTCCAGTGCCATCTCCGTGGTGAAGATCCTGAGGGTGCTGAGGGTGCTCCGACCACTCAG
AGCCATCAACAGAGCCAAGGGGTTGAAG
gtgagagagggcccgggcaggagccccagagaggaatgggaggggttacaggggcctcct
cgctccagaaacctcagcccagccatggctgggacccctgtcccatctccctgggcagat
aggggtaaggatgaggctggggtagctatgcttccccaccagcctttccccacctccaac
EXON 22  108 bp
catctccctgggcagataggggtaaggatgaggctggggtagctatgcttccccaccagc
ctttccccacctccaactcatcaggaggcagcaagtcttgcactcctggggtttcctcaa
ctgggctagcagggttactgtgggtgcacccccagtccccattggcccctctgtccccag
CACGTGGTGCAGTGCATGTTCGTGGCCATCAGCACCATCGGGAACATCGTGCTGGTCACT
ACCCTCCTACAGTTCATGTTTGCCTGCATCGGCGTCCAGCTCTTCAAG
gtgagccccagcctgcgcgagcagctccccctcccgctcccagccctggtgcccactctc
aagcacaaggagccccacattgtgaaaacagatgtcttcgaatgcacagatttccatatg
agaatattttattttgaaaaataggtcttcaccacaccaaacacataagtttgcagaaag
EXON 23  53 bp
ctctggggccctgccccaagggcgagttcacgcctctgagaggaagagatgggcttgggc
tccttttttcagatgcctgccttccctccccccttccactgttcactcccagagcccact
tttctatcctgtttccatgacaacatgcctccctccctccctccctcttcctggctgcag
GGGAAGTTCTTCAGGTGCACCGACTTGTCCAAGATGACAGAGGAGGAGTGCAG
gtacatggggcagggagcacagtgggacggtcacggggcagggagcatggtgggacagtc
acggggcagggagcactgtgggagggttacggtcacggggcagggagtgtggcaggacga
tcacagggcaggggactgtgtgttggtggatgacggcccttcaagctggaaactggggaa
EXON 24  147 bp
aggcttaggagggacactcacagaggcccctttcctcggactcgcccagcggtgtcccct
tgggtcccagatctggaacttcatttctccttcacactccccacccagggcccagaggat
gtgggtggggcaaggcagcccagccatgccctgtggagtgactgggcctccctgccacag
GGGCTACTACTACGTGTACAAGGACGGGGACCCCATGCAGATAGAGCTGCGTCACCGCGA
GTGGGTACACAGCGACTTCCACTTCGACAATGTGCTCTCAGCCATGATGTCCCTCTTCAC
GGTCTCCACCTTCGAGGGATGGCCTCA
gtgagtgatggctggggcctaggtccctcatggacatggtcaggtaggaccaggcagcca
gcctgcccttctgcagcccccacggtgctactgctacctgtggcaggcgtccaacaaacc
caccaactctctgatggtttgatggtatgttgactggtcactccaaagtaggcctgacca
EXON 25  202 bp
gccattccaggattgggtctggtctttcctggcgccgacctaactcctgtcccgtaactt
gattgttgagaaggctctcttggctctccacagccagtgggataaagcccatccttccca
gcctgactctctgccttgtcaccccacccagtctgtcctctcttctctgcccacccccag
GCTGCTGTACAAGGCCATAGACTCCAATGCGGAGGACGTGGGTCCCATCTACAACAACCG
TGTGGAGATGGCCATCTTCTTCATCATCTACATCATCCTCATTGCCTTCTTCATGATGAA
CATCTTTGTGGGCTTCGTCATTGTCACCTTCCAGGAGCAGGGAGAGACTGAGTACAAGAA
CTGTGAGCTGGACAAGAACCAG
gtgcctgggctgcctgccagaggtggagggcagagctccagcaggcctcctgctggccca
agccctaggttcagccagggaagagaggcctaagggtgaccccagaacctgcatttgatg
ccaagccctagcctccatgcaccctaccctatctccaaactgaagcaatacaagttggta
EXON 26  159 bp
tgtgataactcaaggggaacccaaagcccaacaggattattcccctaaacagttcacagt
cctcagccacagcccctggccacagctgctcctgacttgcccgtcaatcccatggatgtg
ggtgtggagagggagggaggggcctcttggtgctgacctgtcctgttgtatgtgtcacag
CGCCAATGTGTACAGTATGCCCTGAAGGCCCGCCCACTGAGGTGCTACATTCCCAAAAAC
CCATACCAGTACCAGGTGTGGTACATTGTCACCTCCTCCTACTTTGAATACCTGATGTTT
GCCCTCATCATGCTCAACACCATCTGCCTCGGCATGCAG
gtaagggctccccaggagaaaaatgtctgatcagactgggacctgggccttgggtagggc
aggatgagtagggcaggatagccaggattccccccagtagacatttcttgtgcactgtgt
gctgaggtgctacatggaatacagaagtgaactgcgcacaggccttgtcaccaggcactt
EXON 27  111 bp
ttggcggaactcaggggattgctaaagcagcttctagttttctgagctaaaacaaagtga
gcagggggcccaagaaagggttgggggcttcccaggaagaggcaggggctctgggaatgc
aatctacagggtgggcaaacccggcccccctgacccactgctcctgtgtcccctccacag
CACTACAACCAGTCGGAGCAGATGAACCACATCTCAGACATCCTCAATGTGGCCTTCACT
ATCATCTTCACCCTGGAGATGATCCTCAAGCTCATGGCCTTCAAGGCCAGG
gtgagtgtgggggccaccgggccagatgagaagctggggctggtgggtgggaccttccag
tggaacatccacccccatccctcatcctatcagggctcctttgcccagcacttctgctcc
caacttgctcacccctttgcccacttccaccttcagacacagggcaggcagatcttcatg
EXON 28  84 bp
ggagtgttggagttgggggagcccactggagcaccagtgggaggtggagtcatgggcacc
ccaccttggcctaacccgcagctccgcattagctcgggtgggacactgtcctctgccagc
agccagagctccttcctcccaaagctcaccccctcgctttcccatccttttccttcccag
GGCTACTTTGGAGACCCCTGGAATGTGTTTGACTTCCTGATTGTCATTGGCAGCATCATT
GATGTCATCCTCAGTGAGATCGAC
gtgagtatcaggcaggcagagccatcactagggtgggcccaagagcatgtgttcaatcca
cagatatttgtggggtgcccactgtgtgtacaacatggaaccccaggggttaaaaagatg
gaatgacaagtcacggcttctgccctcaaggaactatcatcctgctgggcagagaggtaa
EXON 29  57 bp
ctcactcccacccaccccgcccctgattggcagccatgtggggtctttagcccctgcctc
tttttctctttaactcttctgtgtgtctgtcctttctgacacgtctcttcacctccctcc
cacatgtccctcctcctctctctcctctccttcccctcccttcgtctcttttctccacag
ACTTTCCTGGCCTCCAGCGGGGGACTGTATTGCCTGGGTGGAGGCTGCGGGAACGTT
gtaatttcaggctgcacgagcctgcctggcacgctcaccagctcctgccctgccacttgc
atgcatgggcctggctgcgtggattgcatggggtggatcagcactcagggctccctcccc
agggcaggccctgctgaggacccaggctaggctcgggtgggggcagaggctctgcagtca
EXON 30  129 bp
agagccctgtgcccaaggatggtcccgaactagtggacagcaggggccagaggcggggct
ggagttcctccatgccacaaacatctccccaaaacacacagtgcacctccctccccgccc
tgccccttacccctctgaggttctgcccccagactgacctctggggctgctgccccgcag
GACCCAGATGAGAGTGCCCGCATCTCCAGCGCCTTCTTCCGCCTGTTCCGTGTCATGAGG
CTGATCAAGCTGCTGAGCCGGGCAGAAGGAGTGCGAACCCTCCTGTGGACGTTCATCAAG
TCCTTCCAG
gtgcaacagggaccctggaaactgcacgtacctggggaggccactagggacatctgcctc
agcccagggtgggccccaggggagccctgggcaaggcagagccctggggagctaacagag
ggcagggctgcagacacacagtggagccctaagacactgactggcgctcccgcccgccct
EXON 31  66 bp
aacagggaccctggaaactgcacgtacctggggaggccactagggacatctgcctcagcc
cagggtgggccccaggggagccctgggcaaggcagagccctggggagctaacagagggca
gggctgcagacacacagtggagccctaagacactgactggcgctcccgcccgccctgcag
GCCCTACCCTACGTGGCTCTGCTCATCGTCATGCTCTTCTTCATCTACGCTGTCATCGGC
ATGCAG
gtgagaggcaggcgggcccaggccaaagcatggatcttggccaagttagagggggcatca
gtggaccctgaggagcctgagcagcacacgggctggaccctccgccctccctgccttgct
cgtgagaaagaaggagggacaacctccctgatcgtggatggctggagtgtcagatgcttg
EXON 32  92 bp
ttacctgatctagaaaataatcccgttttttttggcttcaggtctgatgtggcccgcaat
gaagggaattttggggaagtaggggcgaaggtaggggtcaggcaggagaaggcagtgggg
gataagctgaggggacactttaatctaggttccacagtcagggccctttgtgacttgcag
ATGTTTGGGAAGATCGCCTTGGTGGATGGGACCCAAATAAACCGGAACAACAACTTCCAG
ACCTTCCCACAAGCTGTGCTACTGCTCTTCAG
gcacgcgtctcccgccacccccacccctaccccgctgaccagtccagcctttgctctgtt
ctaatgtgcactggagccagggctggcttcatgggtgtgtgacctgtgcagccacacagg
gtcctatactcagaagggtcccctgcttggttgcatgctctgccgtcactgccttgaaga
EXON 33  160 bp
ggggaaactgaggcccagctcacactgagctacacagtgaacatgaagatctgacctcct
taccattggacaacagccccagtttgctcatctgtccacaccctgctgccacctgactgc
cagccttctgaggggccaggcaggagcagataggtgacaggagcctcttctgtcctctag
GTGTGCAACAGGTGAGGCCTGGCAGGAGATCCTACTGGCCTGCAGCTATGGGAAGCTGTG
TGACCCAGAGTCGGACTATGCCCCAGGGGAGGAGTACACATGTGGCACCAACTTTGCATA
CTACTACTTCATCAGCTTCTACATGCTCTGTGCCTTCCTG
gtgagatgctgagggcctgcggggcagggagagggctttgataagctgaggcatggggga
gcctgcctgccccttcctggccagtttccacctctcctgggattcatctcggggacgcag
gaggctctagttaggttgtcccccattctggtcatcctgagtgtggctttgtttcctggg
EXON 34  128 bp
caagagcacagagacatgacagagcattgctgtgtgtgtgatgtgggtggttcagaaggg
ctagaatcaagggcacaggaagcgagaagttgtgggccagtggacacctcccagctcccc
caccctaaccctgtaccacctgcctttctgtgttgggaccccttggttcttctcttgcag
GTCATCAACCTCTTTGTGGCTGTCATCATGGACAATTTTGACTACCTCACCCGGGACTGG
TCCATCCTGGGCCCTCATCACCTGGATGAGTTCAAGGCCATCTGGGCAGAGTATGACCCA
GAGGCTAA
gtgagtccaatctgtaggctctgtgctgggccctccatcctagacccttcctaccgtctc
acagggagtcactctccagtttattcagtatgagtgggcttctccttcccccttcattta
tctgaggtctcagatcagagaatcagagtatctccaggttggagggaatcctacagcttt
EXON 35  97 bp
atcctaacattgtctcttcttttaaaagggagctgggctcccacttcctaaacacagttg
gaaaataaggaaatgctcccctgtttcctggctttctttcccattgcccatcctctgagc
agaaaggttctggcagcggaggagggtagcaggtacacaagtctgtgtgtcctcccgcag
GGGGAGAATCAAACACCTGGACGTGGTGACCCTGCTGAGAAGGATTCAGCCCCCTCTGGG
CTTTGGGAAGTTCTGCCCACATCGGGTAGCTTGTAAG
gtaaccagagctgccagggatgggtggccccagggaggggaagagtcactgaggcagagg
gaaactggtgaggacctgatggagtgaagcattgtagagccgggatctcctgggtcccca
agttcctcccaaagggcctgaagtctcagcaatgtcacccaactcatcattctgtcccct
EXON 36  103 bp
tgaagtctcagcaatgtcacccaactcatcattctgtcccctcacaaaggatgtcctggt
cagctgacacccccagccctcgtgtcccgtcccctcccggtccacagaccgggtgaggat
gacttgccaagcttggcctggtcccagctcagcggcaggccactgcgtctccctgtacag
CGGCTGGTGGGCATGAACATGCCCCTGAACAGCGACGGCACAGTCACCTTCAATGCCACA
CTCTTTGCCCTGGTCCGCACGGCACTCAAGATCAAGACGGAAG
gtgagagtgccttccaatgtgagccccctcctttctcccagaggctgtttctggcacaga
ttctgccagattctcagagctcaagattgctcttaagaactgtgggaagaagtagaggga
ggaccccaggccatgggcacaaagtcctcatgcccctcagggctcagagggagcctgagg
EXON 37  102 bp
ccccagggggacagtgatgccctcccaccattgccagtacccagcaaggcagctgccaca
aaactcagccaatgtttcttagtaaatgactggctgtctgaaaggttcagaaagaactgg
gtggccttgtcaagtgcagttggtgtgatctgggtaacttttgcctttctcctgctccag
GTAACTTTGAGCAGGCCAACGAGGAGCTGAGGGCCATCATCAAGAAGATCTGGAAGAGAA
CCAGCATGAAGCTCTTGGACCAGGTCATCCCTCCAATAGGAG
gtaggtgctactttgggggaccagagtccagaagcagccaaggaatgggagtggggagct
tctccaaggagccccatgggaatctgagaacggaccagatcctccataaatgccttaggt
agatcccacgggcatccaacctcaggatggaaagtgcccagtgaccaagtcagcaagaca
EXON 38  125 bp
ataaatgccttaggtagatcccacgggcatccaacctcaggatggaaagtgcccagtgac
caagtcagcaagacaaaggattgcttgcatgcccgggcctggctacagctggctcccact
ctgaatccagtgtcagattcccactagccttcagggcatctcttgttggctcctctgcag
ATGATGAGGTGACAGTGGGGAAGTTCTACGCCACATTCCTCATCCAGGAGCACTTCCGGA
AGTTCATGAAACGCCAAGAGGAGTATTATGGCTATCGGCCCAAGAAGGACATTGTACAGA
TCCAG
gtaagcccaatccaggtatgttccaaggggctcccccactgagccaggtctccagactct
agttatccttccatgtccttgaggggccaatgatggagacatagagggaaaaaggaagcc
cagaagagtgaaaaaatgtcaagacagttctgggtagtccatgattgaagatgtttcaac
EXON 39  129 bp
caggaggctgaggcaggagaatcacttgaacccgggaagcagaggttacagtgagctcag
attgtgccactgcactccagcctgggcaacagagtgagactctgtctcaaaaaaagaaaa
agtggttctggtctcctctcctgggctggagagataactgagtcccttcgtcatccccag
GCAGGGCTGCGGACCATTGAGGAAGAGGCAGCCCCCGAGATCTGTCGCACGGTCTCAGGA
GACCTGGCTGCTGAGGAGGAGCTGGAGAGAGCCATGGTGGAGGCTGCGATGGAGGAGGGA
ATATTCCGG
gtgagggagagccaggagcacccctagtggtctagacaccatgagtggcagtgtctcaca
gagaggagggctgggagcccagccacacgagagggggacatgggagctgaagatacccca
ctccgtctctccacttcaccacccacctctcctgggactcagaatcaatgacctgatcta
EXON 40  251 bp
aactttctaagggtgggaattttcttcttttgatctcaccactcagtccatcctcctttg
gccttataagatttgtctcccaatactattgcttgttcccaataccactgtcccagagtg
acagccccccatgccctccctgccctcacccccagtcactgctcttctccttgcccctag
AGGACTGGAGGCCTGTTTGGCCAGGTGGACAACTTCCTGGAAAGGACCAACTCCCTGCCC
CCCGTCATGGCCAATCAGAGACCCCTCCAGTTTGCTGAGATAGAGATGGAAGAGATGGAG
TCACCTGTCTTCTTGGAGGACTTCCCACAAGATCCACGCACCAACCCCCTGGCTCGTGCC
AATACCAACAATGCCAACGCCAATGTCGCCTATGGCAACAGCAACCATAGCAACAGCCAT
GTGTTTTCCAG
gtagtggcggccactgccatccctgggtgtagaggtactgggaggacaatgtcagcaggt
tccaggttggattggaagagggtaccccaaatttgtagggtgtcttttgcttgcctttgt
gccccaatccatcctgaaccttaatgtaagaggccgacctcgatggcagaggcttctttg
EXON 41  86 bp
ctagagagtcagggctggctggggcacagtggtggaaacgtcagccctagagtcacggct
gctacactaggttggccttgtacaggctctgagggaaaaggatgtttggggccagagagg
cagggatgccgagagagctagcagccttctctggttcacccagccttgcttccatttcag
TGTCCACTATGAAAGGGAGTTCCCAGAAGAGACAGAGACGCCTGCTACCAGAGGACGAGC
CCTTGGCCAACCCTGCAGGGTCCTGG
gtcagtcccttctgtgcatctaagaagcttgagtcttctcccagaggagtccgggaagcc
ccactcttttcttagagtctgggaacttggctgggagggctggcttgggagcctgttaca
atggcagtcatctgggccctggaatgggaaaaccatcaggaccagctacttgtccagggg
EXON 42  92 bp
tgcctggcctggagttgattgggcctcatcatgtgtccaccctctaagacaccttctgca
gccctgagaatctcagagctctcacagagtgtggctagccagccaagcgagcctctgttg
actcagggctcctggcaggagtcagcagcccctcttatccttgccccttcttgcatacag
GACCCCACAGCAAACCCTGTGTGGAGATGCTGAAGGGACTGCTGACCCAGAGGGCAATGC
CCAGAGGCCAGGCACCTCCTGCCCCCTGCCAG
gtaacagtggcagaggcctgggagcaaactccatacagagaccctgcctggcctgatact
tggagtgggatcatggcaggggaaggctgtggcagcaatgtgtccaacagtacagaaggg
acgggatccctccatcctcccctttctgtggatcttggttgagttgccctcagatgatct
EXON 43  144 bp
ggatcatggcaggggaaggctgtggcagcaatgtgtccaacagtacagaagggacgggat
ccctccatcctcccctttctgtggatcttggttgagttgccctcagatgatctggaattt
tgctcattggtgggctccagcacccctgtcggggtctttgcttttgtacctttggaacag
TGCCCCAGGGTGGAGTCCTCCATGCCTGAGGACAGAAAGAGCTCCACACCAGGGTCTCTT
CATGAGGAGACACCCCACAGCAGGAGCACCAGGGAGAATACTTCCAGGTGCTCAGCACCA
GCTACAGCCCTGCTGATCCAAAAG
gtgagccaggggctgggtcacagcagtggctgcattgagtggtggccctgtgatggcctg
gcgtggagagagggtagggccaacagaggcaggtccccaaatgtggctccccaggaagac
cccactcagcctactctcctccctgcaggctctggttcgagggggcctgggcaccttggc
EXON 44  569 bp
cagcaccagctacagccctgctgatccaaaaggtgagccaggggctgggtcacagcagtg
gctgcattgagtggtggccctgtgatggcctggcgtggagagagggtagggccaacagag
gcaggtccccaaatgtggctccccaggaagaccccactcagcctactctcctccctgcag
GCTCTGGTTCGAGGGGGCCTGGGCACCTTGGCAGCTGATGCAAACTTCATCATGGCAACA
GGCCAGGCCCTGGCAGATGCCTGCCAAATGGAACCAGAGGAAGTGGAGATCATGGCAACA
GAGCTACTGAAAGGACGAGAGGCCCCAGAGGGCATGGCCAGCTCCCTGGGATGCCTGAAC
CTCGGGTCCTCCCTGGGCAGCCTCGACCAACACCAGGGCTCCCAGGAGACCCTTATTCCT
CCAAGGCTGTGATGCCCACACAGCATCAGCATGGGCTTAGAGCTGGCATGACCAATGGGG
GTGGGGAAGTTGCTGGGGTGGAGAAGGGCTAGCCCACCGCAGCAGCCTCCCTCCCTCTCA
GCAGCTAGATGCATGGCCTGAGGCAGGGTGGTCAGGAACCACCTCAAAAAGTGCGGAGGA
AGTAGCTGGACAGGCCCTGCCCCTCACCAGCAAGAGGCATGATTGGATGGAGCTTCTAAT
GTCATTCAAAAAGGCCTGGTCAGTGCCTGTCTGGCCTAGGGCCACTCCCACCTGCAGGAC
ATTAAAATCTCCAGGCCTGTGACACTGGC
aactggcctctgcttgtccagttttttggactcttctacacctgtgtttccccctcccca
gtcccttccccaggaaccctgcccatgggcttgggagactgggctgtggagaaagacaga
ggggccatctggattatttttctgcatgaggcagagagggacctgttgtgggttctcctg