Gene ANGPTL3 Variant 1
DNA : 7.36 KbNT_032977
mRNA : 1488 bp NM_014495
CDS : 1383 bp NP_055310
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  511 bp
tcatttagcattgatctaactcaatgtggaagaaggttacattcgtgcaagttaacacgg
cttaatgattaactatgttcacctaccaaccttaccttttctgggcaaatattggtatat
atagagttaagaagtctaggtctgcttccagaagaaaacagttccacgttgcttgaaatt
GAAAATCAAGATAAAAATGTTCACAATTAAGCTCCTTCTTTTTATTGTTCCTCTAGTTAT
TTCCTCCAGAATTGATCAAGACAATTCATCATTTGATTCTCTATCTCCAGAGCCAAAATC
AAGATTTGCTATGTTAGACGATGTAAAAATTTTAGCCAATGGCCTCCTTCAGTTGGGACA
TGGTCTTAAAGACTTTGTCCATAAGACGAAGGGCCAAATTAATGACATATTTCAAAAACT
CAACATATTTGATCAGTCTTTTTATGATCTATCGCTGCAAACCAGTGAAATCAAAGAAGA
AGAAAAGGAACTGAGAAGAACTACATATAAACTACAAGTCAAAAATGAAGAGGTAAAGAA
TATGTCACTTGAACTCAACTCAAAACTTGAAAGCCTCCTAGAAGAAAAAATTCTACTTCA
ACAAAAAGTGAAATATTTAGAAGAGCAACTAACTAACTTAATTCAAAATCAACCTGAAAC
TCCAGAACACCCAGAAGTAACTTCACTTAAA
gtaagtagaaaataaagagggttcatgtttatgttttcaatgtggatcttttaaaaaaaa
tatttctaaggcatgccatttgaaatactttgttgcattgttgaaatacttttttttcca
agaaaaataatctccagaaaataaaatttcctattataatttcaagttagttttttgttt
EXON 2  111 bp
taaaatgttaaggacaaaaatatgtgctatttgaaagaagcatacaaggggaaggaattg
ccaatattcatttttcaaatccattattagtttaaaaatttagattatgatagtgttaca
ggaaattaatagaaaagaaagaggaaagcaacttataaccaacctactctctatatccag
ACTTTTGTAGAAAAACAAGATAATAGCATCAAAGACCTTCTCCAGACCGTGGAAGACCAA
TATAAACAATTAAACCAACAGCATAGTCAAATAAAAGAAATAGAAAATCAG
gtaagtcagtattttaatggtatgtcccatctttcacacaggtctgtaaaaacactgaat
cctaaaattatttacaagctttaactggatcatgagtaaaattatcacatcagcataact
gttaaaattgcaggctctgaagctaataaactacctgcatttaaaccatggctctaaaac
EXON 3  115 bp
ttaaatattttgagaacaggtaatctgtacaatctgaataacactgtttatctaaatatc
aaacaccgttataacattatgaactgaaagacaaactgtacttctgacatccttactcag
atttcccctaattgtatattcagtatcattttaaaaaacagatttatattcttttatcag
CTCAGAAGGACTAGTATTCAAGAACCCACAGAAATTTCTCTATCTTCCAAGCCAAGAGCA
CCAAGAACTACTCCCTTTCTTCAGTTGAATGAAATAAGAAATGTAAAACATGATG
gtaagacactttggtgggtttccttcttgaagctattattatcaaattccctattcttag
gacttgttctagactaaaagatagttaagagatatccatcaaatacaatgtatcaaccta
aactggatgctggggttctttttacaccctataaaagacatacctaagacaatcagagaa
EXON 4  114 bp
tggtaagatgattcttacattcttaaataacacgccatctaagaaaaatgctttaacata
aacattactgaaaaaatgctacatttgccacaacttcataaaatgtcaagtgaaatctca
agctccaaagatattattcctattactaaatctgatgtaataacattttattgattctag
GCATTCCTGCTGAATGTACCACCATTTATAACAGAGGTGAACATACAAGTGGCATGTATG
CCATCAGACCCAGCAACTCTCAAGTTTTTCATGTCTACTGTGATGTTATATCAG
gtaaaacctgtctaaggagaatagacagtagttagttcaacttactcattacgtattagg
aagattaacctggttatcattgttttatacatatatatatgaaatatatatgagtattcg
tataaatataatacttttaccttgtttatgtatttactcaatattctccttttcctctaa
EXON 5  96 bp
aattcattaattgcctttcacttaacttttgggaccataataaataataaaatgtattgc
cataacattaataaactaccttacaaaaccaccaattaaaatcaaacaaacaaaaaagtg
ttatttacatctgtcaacataaatctactaaaaatacatgatttcattcattatattcag
GTAGTCCATGGACATTAATTCAACATCGAATAGATGGATCACAAAACTTCAATGAAACGT
GGGAGAACTACAAATATGGTTTTGGGAGGCTTGATG
gtaaggggactacattcaatcattcattcacttgctaatctacaaatatttactgagaac
ctcttatggaccaggtattaggaaaagtagtaacgaacgagaagcagtctcagccttcat
ataatttattatcaaacaattacacatttgttagtaaattacacttattacaactgttat
EXON 6  267 bp
gcacatagctatcttcaataaaattgttttaaaaggtattattttaagatacactaaaat
gatcaagggattcaagactaaacaactcaattagttgcaccaataaaaaacacttaaaaa
aactgtcagtgtccaacctgtacttaataactcacagatttttaaaacttttcttttcag
GAGAATTTTGGTTGGGCCTAGAGAAGATATACTCCATAGTGAAGCAATCTAATTATGTTT
TACGAATTGAGTTGGAAGACTGGAAAGACAACAAACATTATATTGAATATTCTTTTTACT
TGGGAAATCACGAAACCAACTATACGCTACATCTAGTTGCGATTACTGGCAATGTCCCCA
ATGCAATCCCGGAAAACAAAGATTTGGTGTTTTCTACTTGGGATCACAAAGCAAAAGGAC
ACTTCAACTGTCCAGAGGGTTATTCAG
gtatctttttctgataccaatactttattttcatatcttcaaagtatcttcccacattat
tagctattatctgcaatgacaacttttaaaaatccgaatcccaaataagcgttttctctc
tagacgaaaacctcttaactataatgaaagtgttcattctagttcaatcaggtattttac
EXON 7  274 bp
tatagattatttatacagattatttaaaattgggacttatacagattatttaaaactggg
atacatgcatctaaaacactgtaatatttataagaaaggaagataaacttacggggaaat
acagtaacagtaactacatacgagtctgtacccattaaattgcatatctatctcctttag
GAGGCTGGTGGTGGCATGATGAGTGTGGAGAAAACAACCTAAATGGTAAATATAACAAAC
CAAGAGCAAAATCTAAGCCAGAGAGGAGAAGAGGATTATCTTGGAAGTCTCAAAATGGAA
GGTTATACTCTATAAAATCAACCAAAATGTTGATCCATCCAACAGATTCAGAAAGCTTTG
AATGAACTGAGGCAAATTTAAAAGGCAATAATTTAAACATTAACCTCATTCCAAGTTAAT
GTGGTCTAATAATCTGGTATTAAATCCTTAAGAG
aaagcttgagaaatagattttttttatcttaaagtcactgtctatttaagattaaacata
caatcacataaccttaaagaataccgtttacatttctcaatcaaaattcttataatacta
tttgttttaaattttgtgatgtgggaatcaattttagatggtcacaatctagattataat