Gene ANGPTL1 Variant 1
DNA : 20.07 KbNT_004487
mRNA : 2066 bp NM_004673
CDS : 1476 bp NP_004664
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  297 bp
ctgatcccacccccctatttaaggctacaaagaggaaatcctaaggagattcccgccccc
agtctccagcaatttttggtgatgtaatatgtgggctgaacttgagtctactgagaaaga
gggaatcactattcaggggtactgtatatacaatctgggtcagctgcagctggttactgc
ATTTCTCCATGTGGCAGACAGAGCAAAGCCACAACGCTTTCTCTGCTGGATTAAAGACGG
CCCACAGACCAGAACTTCCACTATACTACTTAAAATTACATAGGTGGCTTGTCAAATTCA
ATTGATTAGTATTGTAAAAGGAAAAAGAAGTTCCTTCTTACAGCTTGGATTCAACGGTCC
AAAACAAAAATGCAGCTGCCATTAAAGTCACAGATGAACAAACTTCTACACTGATTTTTA
AAATCAAGAATAAGGGCAGCAAGTTTCTGGATTCACTGAATCAACAGACACAAAAAG
gtatttaatatttcttttatttaaaaatattatgtatagcaaatgcataactattttata
tttgtagtagaaatttcagaatcttttactaaacaaagacctttggaatatactacagtt
tatctcatctgaaaaaggttttatcttgcaacttgacataaaaacattaagtactgtgca
EXON 2  110 bp
tcttcccagaacatatttcacaatctagaaattctttatctaacatatcctgaatgcttc
ataaatttaacttcattgcctcatgctgttttcagtgcatgacacagccagttaaatgcc
tctgtgagtttaccatctgaaaggaggcaaatcctgactttcgtttcttctctctactag
CTGGCAATATAGCAACTATGAAGAGAAAAGCTACTAATAAAATTAACCCAACGCATAGAA
GACTTTTTTTTCTCTTCTAAAAACAACTAAGTAAAGACTTAAATTTAAAC
gtaagtattctataactaatttataacattctcttggggcctaggaaaattttaacatat
acagaaagttttatgaggtaacatagatttatggatcttttgcttcaaaactgaacatat
gtgagaaaatattaaataagagaatgttttcagaaaacataacagtaaatgtatttttaa
EXON 3  849 bp
ccaaagtattacaacttaatattaaatttaagaaattaataaagttaattctagcctaat
ctattaacaccaataaatattcagtttttccctcagatagtttttaagattactgacttt
aacatagattaatatgaattctttttgctttttctccttcactgatttgtttttcaaaag
ACATCATTTTACAACCTCATTTCAAAATGAAGACTTTTACCTGGACCCTAGGTGTGCTAT
TCTTCCTACTAGTGGACACTGGACATTGCAGAGGTGGACAATTCAAAATTAAAAAAATAA
ACCAGAGAAGATACCCTCGTGCCACAGATGGTAAAGAGGAAGCAAAGAAATGTGCATACA
CATTCCTGGTACCTGAACAAAGAATAACAGGGCCAATCTGTGTCAACACCAAGGGGCAAG
ATGCAAGTACCATTAAAGACATGATCACCAGGATGGACCTTGAAAACCTGAAGGATGTGC
TCTCCAGGCAGAAGCGGGAGATAGATGTTCTGCAACTGGTGGTGGATGTAGATGGAAACA
TTGTGAATGAGGTAAAGCTGCTGAGAAAGGAAAGCCGTAACATGAACTCTCGTGTTACTC
AACTCTATATGCAATTATTACATGAGATTATCCGTAAGAGGGATAATTCACTTGAACTTT
CCCAACTGGAAAACAAAATCCTCAATGTCACCACAGAAATGTTGAAGATGGCAACAAGAT
ACAGGGAACTAGAGGTGAAATACGCTTCCTTGACTGATCTTGTCAATAACCAATCTGTGA
TGATCACTTTGTTGGAAGAACAGTGCTTGAGGATATTTTCCCGACAAGACACCCATGTGT
CTCCCCCACTTGTCCAGGTGGTGCCACAACATATTCCTAACAGCCAACAGTATACTCCTG
GTCTGCTGGGAGGTAACGAGATTCAGAGGGATCCAGGTTATCCCAGAGATTTAATGCCAC
CACCTGATCTGGCAACTTCTCCCACCAAAAGCCCTTTCAAGATACCACCGGTAACTTTCA
TCAATGAAG
gtgagttacctcttactgtaaaaagtgggagtatgaggtttatatttttatgccttatga
aacaatgctcataataaatgcttattcattttgcgatgttatatatgtacattaaaattt
ctattgttttttattaatatcaagaattgaacttaaatacatctcctcttccagctctga
EXON 4  194 bp
ttaatgttccagatagaactggagtcacccttttatttagttatattttataatattgta
tatatgataaacaatggtaactgtaaacaaagacacaaaggtaaaaatcttgattaaaaa
cttttaacatgtctcttctcatattaagtttgctgataataaatgatatttaaattatag
GACCATTCAAAGACTGTCAGCAAGCAAAAGAAGCTGGGCATTCGGTCAGTGGGATTTATA
TGATTAAACCTGAAAACAGCAATGGACCAATGCAGTTATGGTGTGAAAACAGTTTGGACC
CTGGGGGTTGGACTGTTATTCAGAAAAGAACAGACGGCTCTGTCAACTTCTTCAGAAATT
GGGAAAATTATAAG
gtaaatcagtgatgcagacctaagggaagtaaaacaaatccattcttgcaataatgcaag
aaacaagatgctatgcaataaataagacacacagttaaaaataactatccatatgttttt
tcattatctacatctgtcaaaaaaatgattctcatctctggttttaaagtcaaaattaaa
EXON 5  271 bp
aacaaaaagagaatgacaatgtgtggcttataaaacgcaagtgaccaactaaaatggaag
ctcacattaccacttaaatggccagtatctttatgctatcgaatgtttaacactgctctg
taaaaatgtttactatctctatacttatttatgcactcatgtttcttcacttattaacag
AAAGGGTTTGGAAACATTGACGGAGAATACTGGCTTGGACTGGAAAATATCTATATGCTT
AGCAATCAAGATAATTACAAGTTATTGATTGAATTAGAAGACTGGAGTGATAAAAAAGTC
TATGCAGAATACAGCAGCTTTCGTCTGGAACCTGAAAGTGAATTCTATAGACTGCGCCTG
GGAACTTACCAGGGAAATGCAGGGGATTCTATGATGTGGCATAATGGTAAACAATTCACC
ACACTGGACAGAGATAAAGATATGTATGCAG
gtaagtatgaaaaactttcattctttgtagaatcatcaccttctatgcattaaatagaat
ctactaatatatatgctactaaagtcttttcaaaaaggtcagttttggtcactgtggcag
gaaatacaaccaacctactgaaagaaatagcttttaggatttcttctataaggcaatccc
EXON 6  345 bp
tttttcaagcagttgatgcaacagccatcaagtaagtgaaggcatttaaaactgctgaga
taaaggtaactgggattagtaagggaagttcaaattaaaggtagaataagttttttatga
ttgcagagtaccacacctagaagaaacttttacatttatatctgtattttttcctcaaag
GAAACTGCGCCCACTTTCATAAAGGAGGCTGGTGGTACAATGCCTGTGCACATTCTAACC
TAAATGGAGTATGGTACAGAGGAGGCCATTACAGAAGCAAGCACCAAGATGGAATTTTCT
GGGCCGAATACAGAGGCGGGTCATACTCCTTAAGAGCAGTTCAGATGATGATCAAGCCTA
TTGACTGAAGAGAGACACTCGCCAATTTAAATGACACAGAACTTTGTACTTTTCAGCTCT
TAAAAATGTAAATGTTACATGTATATTACTTGGCACAATTTATTTCTACACAGAAAGTTT
TTAAAATGAATTTTACCGTAACTATAAAAGGGAACCTATAAATGT
agtttcatctgtcgtcaattactgcagaaaattatgtgtatccacaacctagttatttta
aaaattatgttgactaaatacaaagtttgttttctaaaatgtaaatatttgccacaatgt
aaagcaaatcttagctatattttaaatcataaataacatgttcaagatacttaacaattt