Gene AGT Variant 1
DNA : 11.58 KbNT_021973
mRNA : 2099 bp NM_000029
CDS : 1458 bp NP_000020
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  36 bp
cactaagacttcctggaagaggtcccagcgtgagtgtcgcttctggcatctgtccttctg
gccagcctgtggtctggccaagtgatgtaaccctcctctccagcctgtgcacaggcagcc
tgggaacagctccatccccacccctcagctataaatagggcatcgtgacccggccggggg
AAGAAGCTGCCGTTGTTCTGGGTACTACAGCAGAAG
gtaagccgggggccccctcagctccttctcggtcttgtctctctcagatgtaactgagct
gtgggctaggaggaaaaggccgggaggaggcacggtgatgactgaaaaacctctcccctc
tcataagaccagtcatccggacgcgggctttcccccactcggtgcccacctggggtctta
EXON 2  859 bp
gatcatgtagatattttccatggagctttgaatccatttcttcttttttttgtagacatg
aatggatttattctgggctaaatggtgacagggaatattgagacaatgaaagatctggtt
agatggcacttaaaggtcagttaataaccacctttcaccctttgcaaaatgatatttcag
GGTATGCGGAAGCGAGCACCCCAGTCTGAGATGGCTCCTGCCGGTGTGAGCCTGAGGGCC
ACCATCCTCTGCCTCCTGGCCTGGGCTGGCCTGGCTGCAGGTGACCGGGTGTACATACAC
CCCTTCCACCTCGTCATCCACAATGAGAGTACCTGTGAGCAGCTGGCAAAGGCCAATGCC
GGGAAGCCCAAAGACCCCACCTTCATACCTGCTCCAATTCAGGCCAAGACATCCCCTGTG
GATGAAAAGGCCCTACAGGACCAGCTGGTGCTAGTCGCTGCAAAACTTGACACCGAAGAC
AAGTTGAGGGCCGCAATGGTCGGGATGCTGGCCAACTTCTTGGGCTTCCGTATATATGGC
ATGCACAGTGAGCTATGGGGCGTGGTCCATGGGGCCACCGTCCTCTCCCCAACGGCTGTC
TTTGGCACCCTGGCCTCTCTCTATCTGGGAGCCTTGGACCACACAGCTGACAGGCTACAG
GCAATCCTGGGTGTTCCTTGGAAGGACAAGAACTGCACCTCCCGGCTGGATGCGCACAAG
GTCCTGTCTGCCCTGCAGGCTGTACAGGGCCTGCTAGTGGCCCAGGGCAGGGCTGATAGC
CAGGCCCAGCTGCTGCTGTCCACGGTGGTGGGCGTGTTCACAGCCCCAGGCCTGCACCTG
AAGCAGCCGTTTGTGCAGGGCCTGGCTCTCTATACCCCTGTGGTCCTCCCACGCTCTCTG
GACTTCACAGAACTGGATGTTGCTGCTGAGAAGATTGACAGGTTCATGCAGGCTGTGACA
GGATGGAAGACTGGCTGCTCCCTGATGGGAGCCAGTGTGGACAGCACCCTGGCTTTCAAC
ACCTACGTCCACTTCCAAG
gtaaggcaaacctctctgctggctctggccctaggacttagtatccaatgtgtagctgag
atcagccagtcaggccttggagatgggcagggggcagccctgcggacatacctggtgacc
acccttgagaagtggggaagtggctgctccgctgggtccctggatgggccgtccacctcc
EXON 3  268 bp
aatatttgagccacacttgcggtcctgtggccaggagaatgcagagtggcctgggggggg
ccaaggaaggaggctgaggcagggcgaggggcaggatctgggcctttggtgtctgccagc
cctcattcctgcccctgtcttgggtgactcttccctccctgtctcctgtctggatttcag
GGAAGATGAAGGGCTTCTCCCTGCTGGCCGAGCCCCAGGAGTTCTGGGTGGACAACAGCA
CCTCAGTGTCTGTTCCCATGCTCTCTGGCATGGGCACCTTCCAGCACTGGAGTGACATCC
AGGACAACTTCTCGGTGACTCAAGTGCCCTTCACTGAGAGCGCCTGCCTGCTGCTGATCC
AGCCTCACTATGCCTCTGACCTGGACAAGGTGGAGGGTCTCACTTTCCAGCAAAACTCCC
TCAACTGGATGAAGAAACTATCTCCCCG
gtaggagcctcccggtctcccctggaatgtgggagccacactgtcctgcccaggctgggg
gcggggtggggagtagacacacctgagctgagccttgggtgcagagcagggcagggccgc
ggtggcacggggctgggcaggcggcctgtgtgtctgtctaccagtcctctatccagccag
EXON 4  145 bp
atttttattgtaggttttgctgaaattttccccaagggggaggatgacttagttgggtga
tggggggagcaaacatccctgtcgtcagggttgggtgcaaggagcataagcctgcctggc
ctctgggagagccctcactgtgtggcctggagccttcctaactgtgcatcatctccccag
GACCATCCACCTGACCATGCCCCAACTGGTGCTGCAAGGATCTTATGACCTGCAGGACCT
GCTCGCCCAGGCTGAGCTGCCCGCCATTCTGCACACCGAGCTGAACCTGCAAAAATTGAG
CAATGACCGCATCAGGGTGGGGGAG
gtatgtgtgagcctgtgtctgtgcctgacctgggttccaagtgtgcacagggtgggaggc
atggatgtaagggacacagaggaggctatgggtggggccagcagggcaagagggagcgga
gagtagggccaaaggtgggagagaagtagccagagcattctggggccttccaggtgcaga
EXON 5  791 bp
acccttgcctacactgaggggcaggcatacactgtgcatcctcctggcaggctggaaaat
gtccccctccaggacagtgcacagcacagaggtcctgagcccaccccggccctctagccc
tcagcaccctgggtcacccagtgcgccctcagaatgatcctgatgtctgctgctttgcag
GTGCTGAACAGCATTTTTTTTGAGCTTGAAGCGGATGAGAGAGAGCCCACAGAGTCTACC
CAACAGCTTAACAAGCCTGAGGTCTTGGAGGTGACCCTGAACCGCCCATTCCTGTTTGCT
GTGTATGATCAAAGCGCCACTGCCCTGCACTTCCTGGGCCGCGTGGCCAACCCGCTGAGC
ACAGCATGAGGCCAGGGCCCCAGAACACAGTGCCTGGCAAGGCCTCTGCCCCTGGCCTTT
GAGGCAAAGGCCAGCAGCAGATAACAACCCCGGACAAATCAGCGATGTGTCACCCCCAGT
CTCCCACCTTTTCTTCTAATGAGTCGACTTTGAGCTGGAAAGCAGCCGTTTCTCCTTGGT
CTAAGTGTGCTGCATGGAGTGAGCAGTAGAAGCCTGCAGCGGCACAAATGCACCTCCCAG
TTTGCTGGGTTTATTTTAGAGAATGGGGGTGGGGAGGCAAGAACCAGTGTTTAGCGCGGG
ACTACTGTTCCAAAAAGAATTCCAACCGACCAGCTTGTTTGTGAAACAAAAAAGTGTTCC
CTTTTCAAGTTGAGAACAAAAATTGGGTTTTAAAATTAAAGTATACATTTTTGCATTGCC
TTCGGTTTGTATTTAGTGTCTTGAATGTAAGAACATGACCTCCGTGTAGTGTCTGTAATA
CCTTAGTTTTTTCCACAGATGCTTGTGATTTTTGAACAATACGTGAAAGATGCAAGCACC
TGAATTTCTGTTTGAATGCGGAACCATAGCTGGTTATTTCTCCCTTGTGTTAGTAATAAA
CGTCTTGCCAC
aataagcctccaaaaattttatctttcatttagcagccaaacagatgtatacaattcagc
agatagactgtgcaaacgaaagtgctttcctggactttggatggaatttccatgggaggt
ctgagccagtacttagcagtcctttgaagttttaggtgatgcttttctctggacacttcc