Gene ACTN2 Variant 1
DNA : 77.44 KbNT_004836
mRNA : 4181 bp NM_001103
CDS : 2685 bp NP_001094
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  301 bp
gggcggcggctgcaggggagacagtggaggggcccggcgcccttgtccgcccgcacgtgc
tcggggcggggcggctggggcccgacgggcggggccgggggcggtggcggcgggggcgtg
gccgggcggccacgtgacgggcggcgcggctattaagccgcgcggcagctgctcgcagcc
GGAGCTGGTGCTTCGCCCGAGACCCAGCGCCCAGGCGTGTCGCCCCGAGAGGAGCCGCGC
GAAGGTCACCCCGCGCCCGCCGCCCGCCGCCCGCCGCCTCCGTGGGTCCGTTTGCCAGTC
AGCCCGTGCGTCCGAGCCCCTCGCGCCCCGCCGCAGCCCCGGCCAACCGAGCGCCATGAA
CCAGATAGAGCCCGGCGTGCAGTACAACTACGTGTACGACGAGGATGAGTACATGATCCA
GGAGGAGGAGTGGGACCGCGACCTGCTCCTGGACCCAGCCTGGGAGAAGCAGCAGAGGAA
G
gtcagcaggggcccgcgggccgcccgcgcgtggtggggccgggtcccccgcggggctccc
gtgcgcgtggccgcgtggcctggcgactggcgagagggcgctttgtggaggtgctgtgct
gtcctgtgccctcgcagccccgggggccccttaggaaagaggacacgtccggggacaggc
EXON 2  115 bp
ctaaaatcgttcttttgggtttccagttcttctttccatcaaattctgcatcctctagaa
gcccaagcagccccagccttgtagattcccaagaacgtgtaaggtgtcaagtgtcgtctg
tgaggaagggatctgaaatccgatggacctgtgctaaaccgtgtttggttttctttgcag
ACCTTCACTGCCTGGTGTAACTCCCACCTAAGGAAAGCCGGCACCCAGATTGAGAACATC
GAGGAAGACTTCAGGAATGGCCTTAAGCTCATGCTGCTTTTGGAAGTCATCTCAG
gttggtgttatatatcccatcctatgctttcatgtgttatcagtaggtgagcatctattt
aaagatgactacatcagaagttcgctttgaacttggctgggcaagaacatggtattattg
ccaaagaaaacctttccaaagaacaatctgcctggagttatttttccgttctaaaaaaag
EXON 3  120 bp
tgaaagtttctgggttagtgttccctcattgctgtgatttagagagaccaggcacacatc
agaaatagtcatgtaaccttctctttttaaggaaaagatggatgcttagttttggcatct
tgattccgcatcaagaggtcactgtctctatgtctgcatgattctcttttcatccaacag
GGGAAAGGCTGCCCAAACCTGACCGGGGAAAAATGCGGTTCCACAAAATTGCTAATGTCA
ACAAAGCTTTGGATTACATAGCCAGCAAAGGGGTGAAACTGGTGTCCATTGGCGCTGAAG

gtgagaggtgtggtgggtggtcctgtctgccacactgacctaatagcgtaggtgtgggct
gcgacttgaattctccccttcttccctccctttcaccatttactgtacctgccttgtatc
aggctctctcttagggcgctcggtgcacaaagataagaacaaatggtaccatgagtggga
EXON 4  87 bp
tttggttatgaatactgtatttataaccagacatactgcggtgcttataaaaacataaac
tggtctttccatccatatgcacattttccaatagctctgaagtcaacatttatatatagg
aaaaaagttacgtacagactatgttatctttacattaatttgttgttttcttacctgcag
AAATTGTTGATGGCAACGTGAAAATGACCCTGGGTATGATCTGGACCATCATCCTTCGCT
TTGCTATTCAGGATATTTCGGTTGAAG
gtaaaagacatggttaaaagtctaattgtataatctgtaaattgagcttgtgaattaaaa
tttgagcaagatgttttaaagtccaacagtcacttacatgattgaatgagagacatgtaa
gtgggttcttataaattttgtatgtgtataggaaaagacctcggcagcactgtttcattc
EXON 5  88 bp
aagtgtcatcagaatttactcaccaagatcagggttctggctcctatgcacttgccgagg
ctgtaggaagagaccccctgggtgatcgaccccctgggaggtctgtttcaaaagtgacta
ggagctaagtgaactaagcggcatttccctggggccactttttcttggctgtcattacag
AAACATCTGCCAAAGAAGGTCTGCTGCTTTGGTGTCAGAGGAAAACTGCTCCTTATAGAA
ATGTGAACATTCAGAACTTCCATACTAG
gtgagcacccagggcccctggtccttgtattctcagtggaatctgtgggtagcatgggga
acagtgtttgtgtgcacccgtgttttcctcctgtctgagaagccttttatgtatcgagga
gaactcaggctgtagaattcttgatgcttaaagtctcccagaggaaaacattggattaag
EXON 6  79 bp
gtggaccctgggaagaagatgagtgttcaagctcaccgggcggggtaaagaggaagctac
atggggccctccgtgcatgaagtcagacagaaggaaggccaacatctgactgagtgcaga
tgctggctgcttctttctctccactaacacgtgttcctgttcttctcgacggctgtgaag
CTGGAAAGATGGCCTTGGACTCTGTGCCCTCATCCACCGACACCGGCCTGACCTCATTGA
CTACTCAAAGCTTAACAAG
gttattctgggtggcctggcatgcagtgtccccagccacgcgtctcagcatgtcctgcaa
atgagcacatcagcactagcctagcacaaaccccagggccacctgcagaaacggccacca
ggaaaaagcacattctcccagctagcctttcccatgatccaagtatgaagagtggccagg
EXON 7  82 bp
ttttgatgtttctctaaatgtttgaagtgattgggaaaagatgaaaaggaaagttacact
attatgattgtgtgtgggtgggaaggtgtccggcctaaagtgaggtacataagaaacatt
cttcataagtcttgtttcaaaatatattttaaaaatctgactgtcttggttttcatacag
GATGACCCCATAGGAAATATTAACCTGGCCATGGAAATCGCTGAGAAGCACCTGGATATT
CCTAAAATGTTGGATGCTGAAG
gtgagatgaaaattgtgtttgctgagttacaggaaatttgaagactacaaatgttatggc
tacacattgggaccttgcaaaattttatagcgaagttacatccgaagtactttggattcc
taacaaatttctgtcactggccacataagtagtagagattttcatgtgtagcttgttcat
EXON 8  86 bp
aatcatttcgatacaatatggccttcctgaggttcgggaccacgggcccatgaaacacag
aaatctggtcagtgtaaaccaatttgttcttccctctgttctccctggtttctctccttc
gtctgtatgtgtgtggtgtgtgtgtgtgcgcgcgtcctgtgttattttctcccccttcag
ACATCGTGAACACCCCTAAACCCGATGAAAGAGCCATCATGACGTACGTCTCTTGCTTCT
ACCACGCTTTTGCGGGCGCGGAGCAG
gtactcaacacttgtccgtccgggctgttgtgttactctctgttggttttagttgtgtgt
gcatacttgagtgtgtgtttgtgcgcttcacatcttaccttggaatctttctgagtgttt
tctaataacctcatatggcaagttctaaactgtgaaaacttttttttaacagctttaact
EXON 9  93 bp
tgtgaaatgattcatagtacgcataagccatgccttcagtctgaccgcaccctaagctag
actctgcaccgtctacagcacgccaccctcctcgtcccctctcatcacccacctcgttcc
atgctgtgtgtgcgcattcccgtcgacagagccgtcctgtttacctattgtgttttacag
GCCGAGACAGCGGCTAACAGGATATGTAAGGTTCTTGCTGTGAATCAAGAGAATGAGAGG
CTGATGGAAGAATATGAGAGGCTAGCGAGTGAG
gtaaaggaaactggtgacctgcagttctgtccatcctcacgcaggggctgaggcacagag
ggtgaaaaaatactccgtgggggcatatatatatatatatatattttgcatttttcatct
cagataggatgaaagtaggaaaatacacttgatctctgaggttgttcctattgtagtaac
EXON 10  231 bp
ctcgcggccatgggcggacactgaacatctcgttcatgcctctgtgcgtagaggtaccac
atctcagtgattttaggaacattcatcctttacaaattattggatgcctcattttttttt
tttaactgggggagggggcttgctggtgtcttcagcagtatttttgtgtttgcggagcag
CTTTTGGAATGGATTCGTCGCACGATCCCCTGGCTGGAGAACCGGACTCCCGAGAAGACC
ATGCAAGCCATGCAGAAGAAGCTGGAGGACTTCCGGGATTACCGCCGGAAGCACAAGCCA
CCCAAGGTGCAGGAGAAATGCCAGCTGGAGATCAACTTCAACACGCTGCAGACCAAGCTG
CGGATCAGCAACCGTCCTGCCTTCATGCCCTCCGAGGGCAAGATGGTGTCG
gtgagtagcaagcgccaagccctcctggcgccacgggaagccctccttctagcctaaagg
cgtttgacctgggtcaggaggaggcattgacttcttgaatctttttagttgtgtgaatat
cattttggccctgtaaccactttgttcttaatacttttctcccaaccatcatgtacttct
EXON 11  148 bp
agacatttggaagccaaataattgaatggttattgaggtggggggtaaggaaggaaaaga
aaacaaaaggaaaacaccatcaaaatgtagtggagggatttatagaagaagcctgagagg
ccagaatgtaacgaaggtgcttgttacacatttgcttcccttggcttccaaccatcccag
GATATTGCTGGTGCCTGGCAGAGGCTGGAGCAGGCTGAGAAGGGTTACGAGGAGTGGTTG
CTCAATGAGATTCGGAGACTGGAGCGCTTGGAACACCTGGCTGAGAAGTTCAGGCAGAAG
GCCTCAACGCACGAGACTTGGGCTTATG
gtaagtagacaggagtcagattggatttttgaaaaaccagagttgagccatgcccagagc
catgatgcatccttactaactctgtgcctaatgtctgtgacactaaaggtaggtgtcgtc
acctttctctgctcttgtctcagtgccaaatttatttaagaggtaggcatgaaaatttag
EXON 12  151 bp
catcctcagcaggtaacagcctgaattccatcacaaccctggcctgcatcttcagtcctg
cccctctctgtccccttctcttggttctttggaatctcaccgctccctgagaatgtggct
ggcatgaggaagccgctgtgccctcagcatattcatactttcttgctaccacctttgcag
GCAAAGAGCAGATCTTGCTGCAGAAGGATTACGAGTCGGCGTCGCTGACAGAGGTGCGGG
CTCTGCTGCGGAAGCACGAGGCGTTCGAGAGCGACCTGGCAGCGCACCAGGACCGCGTGG
AGCAGATCGCAGCCATCGCGCAGGAGCTCAA
gtatgtgcagatgccctccgtcctcccgggagcccctgggattccacagagaggggagag
aaaggcctgccttgcctttcctgactaaacgcagagggaaccacgctggaggcactctgt
gcagggattctccttgtttctttaaatgtagaaacagattttggttcttagattgtggta
EXON 13  109 bp
ccttccaccccctcacccttctgagcctccactgtctatcagcccactctctatgtccat
gtggatacatttcagatgtttttgtttttaaacttccctgttatttttcttttttagccc
atgttcattttctctcatcatctgggaaagttaatctttatttattttcacttttaatag
TGAACTGGACTATCACGACGCTGTGAATGTCAATGATCGGTGCCAGAAAATTTGTGACCA
GTGGGACCGACTGGGAACGCTTACTCAGAAGAGGAGAGAAGCCCTAGAG
gtgaagtattgaagccacttgttgacatgaaatcttttaatagaagctctttaattaaat
cactggtattcattgtgtgtttctctgtggcatgaaacaggttgcctagtgaaaggaacc
tctaaagaaaacatgaaaagtggaagaaagagggaaatgggaagttgggagctttgtgct
EXON 14  141 bp
acctcagagacctgcagggctcagcctaattgtttgagcatcgggtaatcttttgtagac
acatgctaatacgattaacagaatatcagagaatagtctgttcttatggaacgcctactt
acactttcagtgaattttttaattagtctatgataatgcttgcttctctttattctttag
AGAATGGAGAAATTGCTAGAAACCATTGATCAGCTTCACCTGGAGTTTGCCAAGAGGGCT
GCTCCTTTCAACAATTGGATGGAGGGCGCTATGGAGGATCTGCAAGATATGTTCATTGTC
CACAGCATTGAGGAGATCCAG
gtaatggaaccgcaactctgtatgccctatgcattagaagtgagttgtcatttaaactta
agagtcctgttatttggtttcttgttttcttgctttaaaaaaaaattaacaaatgtggct
agaaagcccaaattacccttgaaccttagcttaaaaatgtgtttagtactctgtgttgca
EXON 15  183 bp
tttccaggaacttgacttctgtgtacctaaagagttttttctaaagcattcagaatgtgt
ttttctccagagactcttgcaatcatcaaggcatttacttgtgtgcggaaaggaatatca
aagcctttgaaattaacactcaagccacattgtttttctccacttgtgtctcgggtgtag
AGTCTGATCACTGCGCATGAGCAGTTCAAGGCCACGCTGCCCGAGGCGGACGGAGAGCGG
CAGTCCATCATGGCCATCCAGAACGAGGTGGAGAAGGTGATTCAGAGCTACAACATCAGA
ATCAGCTCAAGCAACCCGTACAGCACTGTCACCATGGATGAGCTCCGGACCAAGTGGGAC
AAG
gtgggtggctgagggcctggtgtgggaccagggggcattcttgaagctgacgtcgaagga
ggaagttaacgcctcggggacttagggtgacggcctcattttgcatcatgatcaggattt
tcctttatcccaaatttcacaggcaaaacgtgacaaactcttaaggacccttcagcagcg
EXON 16  135 bp
tagtccctagactagggactcctcctccctatcctccctcttccttccccctacaccctc
ctcccttcgtttctccttctccactcccacccccaccccttggactattcccgcattctg
tggttgttcctatgagaccacagctggcctctaacccttgttgtccttgggccctgacag
GTGAAGCAACTCGTGCCCATCCGCGATCAATCCCTGCAGGAGGAGCTGGCTCGCCAGCAT
GCTAACGAGCGTCTGAGGCGCCAGTTTGCTGCCCAAGCCAATGCCATTGGGCCCTGGATC
CAGAACAAGATGGAG
gtaagccagcgccctcccaggcgctgttcacaagccttgcgataagtccctttagccacg
cagcagtgacaccgcacatgctgtggtttccagccacccactcagtcaggtgggagcacc
gttctgttatcaccccggctttatctttcagcccctggctgttggggacagtgtgcaaac
EXON 17  180 bp
ttgttctgcgatgctacccagtccccacttcctctgagaaaagtgaaccgagtgacactg
gccgctgcctgacgctggcctagcatcccatgcagggtctggaacggcgcctcgtgccga
gctcccttagagggcacttcactctgcttctctctctgcttgctcactcgcccccctcag
GAGATTGCCCGGAGCTCCATCCAGATCACAGGAGCCCTGGAAGACCAGATGAACCAGCTG
AAGCAGTATGAGCACAACATCATCAACTATAAGAACAACATCGACAAGCTGGAGGGAGAC
CATCAGCTCATCCAGGAGGCCCTTGTCTTTGACAACAAGCACACGAACTACACGATGGAG

gtacggcagccagacaggcgtgtgccgctcacttctcacggggaccatgccacctcctca
gggtgctttcttcatgcacttgtctttctttgttcctgttaagacctacaagtatgaaag
ttagggatctttaagcctttccagtcactatttgtggaaatgcttcgtgagctatatcga
EXON 18  147 bp
ttctcactacagaatcttgcaacagatgacaaagtagaattttttttcaagtgtggggaa
ggctatcatgagccctgcttagtaagccctttgagtcggctgtactgttatgaaagtaaa
gaggcagagttgacatgctggagagacttagaactgatctttccccttttccctcaatag
CACATTCGTGTTGGATGGGAGCTGCTGCTGACAACCATCGCCAGAACCATCAATGAGGTG
GAGACTCAGATCCTGACGAGAGATGCGAAGGGCATCACCCAGGAGCAGATGAATGAGTTC
AGAGCCTCCTTCAACCACTTTGACAGG
gtaccactctctacttatttgaagggcaatactggggacattaaacaatgtatctgaaat
aatatgcatgctctcgttttaagtcttaaggctccacaacatttacagggaaacaggata
gttaatgacaaaagaaaatagccaccaaaactaagtgtcctaagctttgatgttgctcaa
EXON 19  66 bp
taagaaactagtttgtaacatccttgtgctggctccatccttctcgcaagtcagtggtga
catttacgaccttggcagagctcaaagtgcttctcttaccagatctttgttcagttggtc
aagtagagttgctcatcttgccctgtgctcacctgctctgtcctttgtttttgccaacag
AGGAAGAATGGCCTGATGGATCATGAGGATTTCAGAGCCTGCCTGATTTCCATGGGTTAT
GACCTG
gtaagacagaagttgaaattgtactaagatttgatattttattgaatttggatttctgtt
ataaaagatgacaagctcaaaccaaggtagtgcatttgggattggttcgttttcattata
taggataatattttttgaaggtctcactgttattatataaaaataaagtcacgaggcctg
EXON 20  159 bp
gtagcagtaaaccttagtcacccttaaggggaatcttgtccaaagactgaagggaaacgc
aggtaataattcagttttcagacataaaggaattggcatgtcaccagggaaagaatgaaa
acggctctgttgagagttgtgtaccgttcgtgtacatgtttctttgccactttgccccag
GGTGAAGCCGAATTTGCCCGCATTATGACCCTGGTAGATCCCAACGGGCAAGGCACCGTC
ACCTTCCAATCCTTCATCGACTTCATGACTAGAGAGACGGCTGACACCGACACTGCCGAG
CAGGTCATCGCCTCCTTCCGGATCCTGGCTTCTGATAAG
gtctgcattgacagatttccttctgctttagcaggagtccactacatccttctaacaaaa
aaggcaacagtgttgtaaataaaaaccatttttatgccggtgtattttgtacaacattgg
cactgatttcagaaggcagcagatagacacacaacaatggcgcgcccagcacagaggaaa
EXON 21  1480 bp
acgctcctacaagtaaaacttggctttctgttggttgtctggtactactatgccaataga
ctccctattctttagtccttttaaaaaattaaacagatgcaagaaatatgtaagtattaa
gactgtttatgttgtggtgtttctgcaactgactgcaaacacgtgtgtattttttcccag
CCATACATCCTGGCGGAGGAGCTGCGTCGGGAGCTGCCCCCGGATCAGGCCCAGTACTGC
ATCAAGAGGATGCCCGCCTACTCGGGCCCAGGCAGTGTGCCTGGTGCACTGGATTACGCT
GCGTTCTCTTCCGCACTCTACGGGGAGAGCGATCTGTGATGCTGAGCTTCTGTAATCACT
CATCCCATCAGAATGCAATAAAAGCGGAAGTCACAGTTTGTTTCCTGGAAACTTTGACAA
GCTTTATTAAGTTGAGAGAGAGAGAGGGGAAAAAAAAAAGCCTTTCGTAGTTCAGTAATT
GCCAGCAATATAACACGGCTAAAATGAAGTTTTTACAGTATATGACATAGTGCGCTTCAT
AAATAGGTTTATTTCTGAGTTTTTAGCAAAATGTAATGAAATATCAGGTTGATTTCTTTG
ATTAAACAGAACAAATTACTTGAGTAATAGGAAATTAGGAGGATCTAGGGACAGAAGGAA
AGTGAAAAATGTGAAAATACAAAATACCCAAGATTTAAGACCGGGGGGAAAAAACCACAA
ATTGGTAAATAAAGGTTTGCTATTTGTAAAAAATTTCATTTATCTCTAATATGCTTATGT
GATTGCCCCTAGGGGAGTATATTTGGGATTCTAATGTTTTATTTTCATGCTTATCCAAAG
ATTACTATTGTATCTTCAAATGAATTTAATATTGTGAGATGGAACTGCCGGGGATTAAAA
AGACTACCCAAAAGATTTTTGGCACTTACAATTTTTAAAATAGTTTATGTCATCTCTTCA
TTATTTAGGGCTGGATGGTCAACTCAGTCAGTGATTTTTTGATGCTTCTCTTATCCTCCA
GAATAGAGACCTAAGGACACGTGGAAGTCAGTTTAATTGCCAGAGAGAAGGATGCAATCA
CTAGGTAAAATGAGGTTTTTAGGATTATTTATTGATTCCAGGTTCCCATGCTTTTTGTTA
GAGCTTATTAGTACAGGTTCTCAAGAGATGACCACATAAAAGTGCTCTGTTTATAAATAA
GCAGGTTTCTGTAGTACTGACTGGTTCATCACAAGGCAAGTCAGAAACCAGTATCCTTCT
AGCTCTCCAGTCAGGACTTCCTTATGCCTCTAGTTTTATGACCGGTTAAGGAGAAGCCAG
AGTTAGAGTAGGAGAGGACTAATTCTCAGCAGCAGTGGAGGTGAGTTCTTTCTTTTGCGG
AAGCTTTACATATGTTTTGTGTAGTAGGAATAACTAGATATTTTAGCTAGTGTGCGGTGT
GTGTTCACCCCTGGGATTGGACAGTGTATCCTAACAAGTCCCATGTCTGGTTCTGTGTCT
AAAGGCCTGCTCCATGACACAGGATGCTACATGCACTCCTGCTAGCACATCTTGATCTGT
TGAATGTTCATTCTTTCTTTTTGCTCATACTGCTGTAGGCTATAATTCCCCCCTGTTTTT
CCATCTTGTTGACAGCTTGTAGAGAATAAAGCAGGAATTC
tttttatatctgagtccttaatgatcaggaaatggattacaaacaaacaaaaacagttgc
aaacagcaattaaagcattactagagaagcagtaacatgtctgttacctacagtctgttt
gctcagatttttatagatttccaccaacagctggaaatgtaatatttccattccaagctg