--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (7859 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (6 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        401        451   0    Initial     51    56    Marginal
gtgtgtattaatgaaattgaccttacagttctgatctttataataagttataagaaaatg
gtttaatgtgtatgtgtatatatttacttgaagtagaaatatgaacgctaaaaaatggga
agatatttaagttggtgttaaaacagcatttaaaattaccacaattatgagaacacatgt
ATGCCAATGCAGATTCACTGGAAAAATATTGAAAATGAAAACTGTCAGATG
gtaagattataattttatttcttttttaatttgaaataagttggtacagcacagcttttc
aaaagcttctataaatgtgtatgttaagttgtaataaagcaaacacatgcatgtagacat
gcttaaacagttatttaattgtttcttgggtacctggggagatggggtgaagaaaggggg

Exon  2 +       1094       1281   0    Initial    188    68    Marginal
ggtggcaggagacaacacaaccacgttttcttttatgcatgcatttggtttaattgacac
attaaccacagacaaaggggtaaaggccacaaggcgttaggttagtatgaacagggaaag
ggactttttttttttttttttttaagaaaaataaaagcatcagtattgcaaagactttcc
ATGATCCTACACCCACCTCGAAAGCCCCCTCTCACCACAGGAAGTGCACTGACCACTGGA
GGCATAAAAGAGGTCCTCAAAGAGCCCGATCCTCACTCTCCTTGCACAGCTCAGCAGGAC
CTCAGCCATGAGACTTCTCATCCTGGCCCTCCTTGGCATCTGCTCTCTCACTGCATACAT
TGTGGAAG
gtaagtggagaagctgtctgtgagataaagaacagggaggcaaggcaggtgggcacacat
tttgggtttgactcaggttatgactggactaacctgctttccccaggggagccttaaact
tcccatgtgcaagaaaggaatgatgattttgactgtagagggcttcgtaaacttccaaaa

Exon  3 +       2734       2832   0   Terminal     99    87        Good
aaataacacagacactcaaacattgctgacaataaggaaaaggctttgtggtttcaagca
taacaggattccctgagtcttaggagtccacttcagatacttcacagagagaaatattgt
ttcttaaatatgagagaaacagagaaaaaacccagatttttcctctttcattggctacag
AAACAATTCACCACTAAAAATAAATTGGCAAAGGTAGAGGATAGCAATGTGCAGACTGGC
ATTGAGAGTGAAGAAATGATGAAGAAAAGCACACAATGA
acactctttgtttagtcccttgctttaaaaaatgccttctgatattagcaacactacaga
ccaatgttggccattatcagtggttactttagatgctttttagctgcctatttccctggg
aagcaaagaccagtgtctacagctaaggagaaaatcagcacttagaaacttggattagat

Exon  4 +       4646       4760   1   Internal    115   100   Excellent
atttactaagaatctgtgacgggcaagagattcgggatgcctatcagtcctctcttcccc
caaaaagcaaatggccttaaattctcacaacattctcagagtaatttaacagatgattgt
tcctgtgatctggataattgctttatttttaattgtctgttgtttttttttcctcaccag
GTGTAGGGAGTGAAGTCTCAGATAAGAGGACCTGTGTGAGCCTCACTACCCAGCGACTGC
CGGTTAGCAGAATCAAGACCTACACCATCACGGAAGGCTCCTTGAGAGCAGTAAT
gtgagtctgcctcctcagaagttgtgctgggtgggtatctagaagtatagaaatacactc
tgtagaaatgctgccgtcctcaggaaaagtaggtcagcatagaggaacacctcaacttaa
ccaaaaacctctttagttttccttatcaatcatgtctttctgcagcccaaccgaatagcg

Exon  5 +       4926       4976   0   Terminal     51    45    Marginal
cttgagagcagtaatgtgagtctgcctcctcagaagttgtgctgggtgggtatctagaag
tatagaaatacactctgtagaaatgctgccgtcctcaggaaaagtaggtcagcatagagg
aacacctcaacttaaccaaaaacctctttagttttccttatcaatcatgtctttctgcag
CCCAACCGAATAGCGATTATTGCAGAAATTGGGCTGCCAAAGAAAGAATAG
aagtcctcctctatttagcttagtggaagagtctgttgaatactgtgcacagctctgaga
cctgggtttagagatgactggcccatgtcagggtttccctgcaagcctcactggagttgg
gggatcttagggttgagtcaggcagagtcccatacttttatcagttgccatatttcaaga

Exon  6 +       5635       5803   2   Terminal    169    86        Good
tcctttatgttaaaatagatggcagaagaagggtactcatttatgatctcatggctctga
aagactatttcttgcagtaatttctgcacaagatctcttcatgtctgccctgatcttaac
tcctgaccctgaggctttgagaatgtggctaacttcgtctgtcttttccttgcgttacag
TTTTATTACCAAACGTGGCCTAAAAGTCTGTGCTGATCCACAAGCCACATGGGTGAGAGA
CGTGGTCAGGAGCATGGACAGGAAATCCAACACCAGAAATAACATGATCCAGACCAAGCC
AACAGGAACCCAGCAATCGACCAATACAGCTGTGACTCTGACTGGCTAG
tagtctctggcaccctgtccgtctccagccagccagctcatttcactttacacgctcatg
gactgagtttatactcaccttttatgaaagcactgcatgaataaaattattcctttgtat
ttttacttttaaatgtcttctgtattcacttatatgttctaattaataaattatttatta

--------------------------------------------------------------------------------