--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (14691 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (19 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       2727       2898   0    Initial    172    99   Excellent
cgagccaccatgcccagccaagggttgaattttgaggtgactaacgctgcctggtggtgg
gggtagggggtgatgtgggctcgggggagggcataccttagcatttgatcccattctcta
accttgataacccctgcctgaccagtaattgacctgctgactgtgggcgagtctcggcag
ATGGTAGCTGTGGCAGAGAAGATCCGGACAGCCTTGCTCACTGCTGGGGACATCTACCTC
TTATCCACCTTCCGCCTGCCCCCCAAGCAGGGTGGTGTCCTCTTTGGCCTCTATTCTCGC
CAAGACAACACTCGATGGCTGGAGGCCTCTGTTGTAGGCAAGATCAACAAAG
gtgactggtgggcatctcctttcttgcaatggtgacctccttaagcactctccctcatcc
ctacttcccaagtgcttcctcattctccttggcctccattagggaccaaggtcccatcag
gctgtgcccagacatcaggggcacctggtatggggtgcttataaggtgctttaggagccc

Exon  2 +       3782       3937   1   Internal    156    90   Excellent
ctctaaagcaatttcaaaaacatttattgtgtacctattaaatacaaggtgttgagagcc
acatagtagaattagggataggggccctagagatgtggtatctagcagagttgatccaag
gctcagctgggaggcagggggtgggggatagcgcccatactgatctcccctcctgggcag
TACTGGTGCGATACCAGCGGGAGGATGGCAAAGTCCACGCCGTGAACCTACAGCAAGCGG
GCCTGGCTGATGGGCGCACACACACAGTTCTCCTGCGACTCCGAGGTCCCTCCAGACCCA
GCCCTGCCCTACATCTCTACGTGGACTGCAAACTGG
gtgaccaacatgcaggccttccagcactggcccccattcctccagcggaggtcgatgggc
tggagattaggactggacagaaggcgtatttgaggatgcaggtgagccgggaggagcctc
tgagttctgtggaaatagagtttgcaccagctggggaaggggttggtagaccttcccacc

Exon  3 +       4141       4243   0   Internal    103    57    Marginal
gcactggcccccattcctccagcggaggtcgatgggctggagattaggactggacagaag
gcgtatttgaggatgcaggtgagccgggaggagcctctgagttctgtggaaatagagttt
gcaccagctggggaaggggttggtagaccttcccaccttactctgctgctatccccccag
GGCTTTGTGGAATCTATGAAAATTATTCTGGGTGGGTCCATGGCCCGGGTAGGAGCCCTG
AGTGAGTGTCCATTCCAAGGGGACGAGTCCATCCACAGTGCAG
gtaacacagagacttgtttgctgacattggaccacggatcctgtggcctttggtgactcc
tgtcttcttgatctccctctcccttaaaacccattcctttggctcacctgttcctagggt
ttctaaccctgttattccaaatctttcacctgactccacaatctccaatacacccatccg

Exon  4 +       5793       5875   1   Internal     83    96   Excellent
ggggagcggggaggaggccccaggctctggcagctgcctgaaactaagtcctcttcagtc
aggaatgtagtaggtttaaaggcaggggtgggcagccgtggcaggtactggcttattgcc
catggagggcccaggactggtgctccagtactgaacccctcacaccctgggtcccgacag
GGGAGCAGACCAAGGCGCTGGTCACCCAACTCACCCTCTTCAACCAGATCCTGGTGGAGC
TGCGGGATGATATACGAGACCAG
gtttgggtgggctggcgaagggtggcactgattctggggtagggtggcagatgtcaagtg
ctgactcctccccatccttctccaggtgaaggaaatgtccctgatccgaaacaccattat
ggagtgtcaggtgtgcggtgagtgggagagcaggggaggctccacatgaccgtgccacgt

Exon  5 +       5961       6012   0   Internal     52   100   Excellent
gggtcccgacaggggagcagaccaaggcgctggtcacccaactcaccctcttcaaccaga
tcctggtggagctgcgggatgatatacgagaccaggtttgggtgggctggcgaagggtgg
cactgattctggggtagggtggcagatgtcaagtgctgactcctccccatccttctccag
GTGAAGGAAATGTCCCTGATCCGAAACACCATTATGGAGTGTCAGGTGTGCG
gtgagtgggagagcaggggaggctccacatgaccgtgccacgttccccacccaatggctt
tggctttcccttctggtggcttaaatagtgaccaccgggtagctctgactgtgtccaccc
ctcaggcttccatgagcagcgttcccactgcagccccaatccctgcttccgaggtgtgga

Exon  6 +       6138       6286   1   Internal    149    98   Excellent
caggtgaaggaaatgtccctgatccgaaacaccattatggagtgtcaggtgtgcggtgag
tgggagagcaggggaggctccacatgaccgtgccacgttccccacccaatggctttggct
ttcccttctggtggcttaaatagtgaccaccgggtagctctgactgtgtccacccctcag
GCTTCCATGAGCAGCGTTCCCACTGCAGCCCCAATCCCTGCTTCCGAGGTGTGGACTGCA
TGGAAGTGTACGAGTACCCAGGCTACCGCTGTGGGCCCTGCCCCCCTGGCCTGCAGGGCA
ACGGCACCCACTGCAGTGACATCAATGAG
gtgagggaggtcagagcccagaagggtacagaaaactggggtgaggatgtcaggaggcac
ccaagagggtgggataaatgctggtccggaggagaggaatctggagtttaggagaggtca
gaggcaagagaaatgcaagatgggagagacagaaggcctggggcaaagactgaaggccat

Exon  7 +       6732       6837   2   Internal    106   100   Excellent
gtggggtggggaccaggagcacaaggcagttgtgtggggagagctgcacaaaggggagac
ctggagcaatggttcctggatcacaggcagggacctgagtttcccagagggcggcctgac
ctctgccttctcatctggtccccagtgtgctcacgctgacccctgtttcccgggctccag
CTGCATCAACACCATGCCCGGCTTCCACTGTGAGGCCTGTCCTCGAGGGTACAAGGGCAC
ACAGGTGTCTGGTGTGGGCATTGACTATGCCCGGGCCAGCAAACAG
gtcagactgggtagtgtgtgtggacaagggatcttggccttgtagaggccaggggcttct
gggttggacatgggacccttgtgatgaatgggacatggatggctttgcatcggctttggg
tctgggcttaatgttgatgttcacagataaggccataccagtgtcctctgctgtatctga

Exon  8 +       7064       7141   0   Internal     78    95   Excellent
ggccaggggcttctgggttggacatgggacccttgtgatgaatgggacatggatggcttt
gcatcggctttgggtctgggcttaatgttgatgttcacagataaggccataccagtgtcc
tctgctgtatctgaggagacccaccataggtctggttccacccaaagtctgccccttcag
GTCTGCAATGACATCGATGAATGCAACGATGGCAACAATGGTGGCTGTGACCCAAACTCC
ATCTGCACCAACACTGTG
gtgagctgaatatcctgagtgtattctggggtggtgggaatggtaaaaccccaacccccg
ccccttcttaccttcaaatttcctgctgcctttcctcctccccagggcactacacagatt
aggtgttcacatggacttggtttggaatactggtttgcctcttgctagctctttagcagg

Exon  9 +       7894       8004   0   Internal    111    79        Good
gagggtctggggaaaggagtagggctatgtttagggcctgggttgggggtcttcatagga
gagaggtgggcctgggcccaggaactgtttggtggggagaataggacctgaagcagggaa
aatatagggaggaggggagccagaccaaactgctagctcctaccctttgtgttgccctag
TGTAACGTGGGCTGGGCTGGGAATGGGAACGTGTGTGGGACTGACACAGACATCGATGGC
TACCCAGACCAAGCACTGCCCTGCATGGACAACAACAAACACTGCAAACAG
gtgcagggagcaggcgggcaagggggcgtagtggggagcccaagctgggtcaggccagaa
ctcatccatcctcttcccctgaactttaggacaactgccttttgacacccaactctgggc
aggaagatgctgataatgatggtgtgggggaccagtgtgatgatgatgctgatggggatg

Exon 10 +       8127       8201   0   Internal     75    98   Excellent
cgatggctacccagaccaagcactgccctgcatggacaacaacaaacactgcaaacaggt
gcagggagcaggcgggcaagggggcgtagtggggagcccaagctgggtcaggccagaact
catccatcctcttcccctgaactttaggacaactgccttttgacacccaactctgggcag
GAAGATGCTGATAATGATGGTGTGGGGGACCAGTGTGATGATGATGCTGATGGGGATGGG
ATCAAGAATGTTGAG
gtgactcccagactgccctgccccttgaagctcctctcccctcctcctgtcctctctgtg
cctcacttacctcatctggcagctctctagtaagggccaaatactccaaatcagggaggc
aaaaacctcgtgcccaggacaaggaggctgggtgggtgggactgtactgagcagtttgtc

Exon 11 +       8488       8647   0   Internal    160   100   Excellent
caaatcagggaggcaaaaacctcgtgcccaggacaaggaggctgggtgggtgggactgta
ctgagcagtttgtccatcacaagggtgtgatcttagaaaaggatacagagacaaggtagg
tgcaagatgacaagtgatttaggggagacctgacccttcccctcccacccctctgcccag
GACAACTGCCGGCTGTTCCCCAACAAAGACCAGCAGAACTCAGATACAGATTCATTTGGT
GATGCCTGTGACAATTGCCCCAACGTTCCCAACAATGACCAGAAGGACACAGATGGCAAT
GGGGAAGGAGATGCCTGTGACAACGACGTGGATGGGGATG
gtgcaggcctggggctgaaggggtggctgggggacctgtgagaatttggatcaggtgggg
atgaagcagggaagctaggaagtctctgtgaaatagggaggcaggcttgtggacgttggc
ctgggtgaggagagattacctgcagcagatgtcaataggaatgtgaggtagggcgtagtg

Exon 12 +       8985       9116   1   Internal    132    81        Good
ggaatgtgaggtagggcgtagtgttaggcagagtgtggactagagggtgagacaagaaac
aggcagatttcctggccagttgtcctctgggtggggagacaaagttcgggactttcacca
acctagaagagagaatatggcatgttctagtaacaaccttgtgctacccatgtcttctag
GCATCCCCAATGGATTGGACAATTGCCCTAAAGTCCCCAACCCACTACAGACAGACAGGG
ATGAGGACGGGGTGGGAGATGCTTGCGACAGCTGCCCTGAAATGAGCAATCCTACCCAGG
TACAGGGAGATG
gtaaggacaggggagggatgagggtactgatggatgaagccccagccctttggatggaaa
gtggtcagatcaccctcttcagagttatcaagaggagatggtgagaacaggtccctctct
ctcagacagatgcagacagcgacctggtgggggatgtctgtgatactaatgaagacaggt

Exon 13 +       9246       9294   1   Internal     49    69    Marginal
cttgcgacagctgccctgaaatgagcaatcctacccaggtacagggagatggtaaggaca
ggggagggatgagggtactgatggatgaagccccagccctttggatggaaagtggtcaga
tcaccctcttcagagttatcaagaggagatggtgagaacaggtccctctctctcagacag
ATGCAGACAGCGACCTGGTGGGGGATGTCTGTGATACTAATGAAGACAG
gtaaggtcttggtcaagagacgcaaggtctttcttttttttgtctttctgagacggagtc
ttgctctgtcacctaggctggagtacagtggcacgatcttggctcactgcaacctccgtc
tcccagggtcaagtgattctcatgcctcaacctccctgagtggctaggattacaggcatg

Exon 14 +      10496      10689   2   Internal    194    98   Excellent
agcaggaatttattcttacagtcatccctccattcctactgccagaccttcacctcacct
ggctgactgccaggggtctgattgtatggagagcaggctccagagactcccaggcagaag
cgaagggaaggacaaggagtacctttaaatcctttatttggtacctgttcttctgattag
CGATGGGGATGGGCATCAGGACACCAAGGACAACTGCCCACAGCTGCCAAATAGCTCCCA
GCTGGACTCTGATAACGATGGACTTGGAGATGAGTGTGATGGGGATGATGACAATGATGG
CATCCCAGATTATGTGCCTCCTGGTCCCGATAACTGCCGCCTGGTACCCAATCCCAATCA
GAAGGACTCAGATG
gtaagcctgcggacccagagcacgttagactggtgttgcctttgcccaggtggaggcagc
aagccctgttgggaagtgaggaagggcaaggtggggaaagatgtcaggaatgcaggccca
acagatggtattgttgcctaatggcagtggccagggccttcctgagcacccagcctcact

Exon 15 +      10878      11056   1   Internal    179    99   Excellent
gcggacccagagcacgttagactggtgttgcctttgcccaggtggaggcagcaagccctg
ttgggaagtgaggaagggcaaggtggggaaagatgtcaggaatgcaggcccaacagatgg
tattgttgcctaatggcagtggccagggccttcctgagcacccagcctcactctgcccag
GCAATGGCGTTGGTGATGTGTGTGAGGATGACTTTGACAATGATGCTGTGGTCGACCCCC
TGGATGTGTGTCCTGAAAGTGCAGAGGTAACGCTTACGGATTTTCGGGCCTATCAGACCG
TCGTCCTGGATCCTGAGGGTGATGCTCAGATTGACCCAAACTGGGTTGTGCTCAACCAG
gtaactcggggcagtgggctgggcaggtgctatcagacagggctactgggacggggggcc
tgggagggatagcacacctgcatcacagctttttctttactatacaaccccagggcatgg
aaatcgttcagaccatgaacagtgaccctggcttggcagttggtatgtaagggatatgca

Exon 16 +      11170      11222   0   Internal     53    66    Marginal
tcagaccgtcgtcctggatcctgagggtgatgctcagattgacccaaactgggttgtgct
caaccaggtaactcggggcagtgggctgggcaggtgctatcagacagggctactgggacg
gggggcctgggagggatagcacacctgcatcacagctttttctttactatacaaccccag
GGCATGGAAATCGTTCAGACCATGAACAGTGACCCTGGCTTGGCAGTTGGTAT
gtaagggatatgcagttcaatcacttccaaatggaggaatcctataggggcagagggtag
gggaggaaacagacagggagaatgggcaaagtggcgagagagaaggcagtggcacaagct
ggccacatacatagcaggcatcccttcccaactttaccccatgatgggccgccagtagct

Exon 17 +      11439      11635   1   Internal    197    99   Excellent
gaatcctataggggcagagggtaggggaggaaacagacagggagaatgggcaaagtggcg
agagagaaggcagtggcacaagctggccacatacatagcaggcatcccttcccaacttta
ccccatgatgggccgccagtagctttgctgcccctgacctttatcccacccccaccccag
GATACACGGCCTTCAATGGTGTGGACTTTGAAGGCACCTTCCATGTGAACACAGTGACTG
ATGATGACTACGCAGGCTTTCTCTTCAGTTATCAAGACAGTGGCCGCTTCTACGTAGTCA
TGTGGAAGCAGACCGAGCAGACCTACTGGCAGGCTACACCCTTCCGGGCGGTTGCCCAGC
CCGGGCTGCAGCTCAAG
gtccccagctgctcagattccgcaacccagggccctttcccaaagctctcctctgcagcc
ccagggcctcccccactgcttgactgggaaccctcttacccagacatctggcttggaggc
cggctctctggggccccagggcattttcatgaccgccttgaatccctttcccacctgcac

Exon 18 +      11960      12057   0   Internal     98    57    Marginal
tttcatgaccgccttgaatccctttcccacctgcacttaccgacctgttgtctcccctca
ctccagttctgcagttgacccactgtctttgccaatgtctcctaggcagtgacatcagtg
tctggcccaggtgagcacctccgaaatgccctgtggcatactggccacacccctgatcag
GTACGACTGCTGTGGACAGACCCACGAAATGTGGGCTGGCGGGACAAGACCTCCTATCGC
TGGCAGCTTCTGCACCGGCCTCAAGTTGGCTACATTCG
gtaaggagaggggctgagcccacctgtgggactcaggccgggcctgtccttcctctttag
ctgggattcaccagtgacctctccatgggtgggaactgcagccacttctctccatcaccc
ttctcaccacggacacaagcacctatgagtgatgttggtgaagtcactcctccatgaccc

Exon 19 +      12861      13116   2   Internal    256    53    Marginal
gacttcaccccccagcccattgtgcttattgtcatggcaacccaatcctcgcttggaatg
cggctggtgctttgagatgcaaaaggagctggacaaagagctaggggccccaggcctgag
aaaagcaccccccttccctctccttcctgcctccctttccctccctcccttctctctcag
GCCTGGTGAGCTCAAGGGGGGCTGGGGAAAAGCAAGGCCCCAGGCATGGTGGCACAGTGC
CCACTGGCACCCTAGCACCAATGGATACTCCTATCCTGGAATCCTGGACAGGGTGAAGCT
CTATGAGGGACCCCAGCTTGTGGCGGATTCTGGGGTGATCATTGACACATCCATGCGAGG
GGGGCGTCTTGGTGTATTCTGCTTCTCCCAAGAAAACATAATTTGGTCCAATCTCCAGTA
TCGATGCAATGGTGAG
gtggctgattgagatcaacctaatccttcatgccttgtgggagagccacatcctctgacc
ttacttatttccccttcttcagacacagtgcctgaggactttgagccattccggaggcag
ctgctccagggaagggtgtgaggaggaggccaccagattcagaattcagaattttagacc

--------------------------------------------------------------------------------