--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (21355 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (13 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1400       1583   0    Initial    184    62    Marginal
ggggctcactgtggtggtgtgagtgggaggcggcggcgctggtggctgcagctggggtga
ggcgcgaggcggcgcactcgacggctgactggagcagcggtaaaggcgaggatggagacc
gaaggtttggggagtgggaaagacagggtcatgggcagccctggccactaggagacggaa
ATGCGGGAGCGAGGGAAGGGAGGGGTCTGGCGTGCCCCGGGGCGAGGGAAGGATGTGGGG
CGCAGCGGGGGAGTCAGAGCCCTGGGCTGTGAGACGCCGCTCGGGGGCAACTTGACCCAC
TGGGAACTCGTAACTGTATCTGAGGAAGATGCTCCAGTCACCCGCTTACGCCACAACGGA
CCCG
gtgcgggagcgtttgtgtttgccctgagtcagttcagactcttccactgggcctttttga
gactgagagctgccatccgtatatcactttgcctttaactttccccagctttttctttag
ttatcgctaataggatggctgtttacagtcgtcagaataatacattggggtttttgtttt

Exon  2 +       2534       2650   1   Internal    117    62    Marginal
tttccatttctctttaagagaaacttatagctgaaaggatatgaaaattgtgaacaaaac
catagtgacagatcaagtagagtctcattttttgagacatcagctgataactcaattagc
acaaattcatttgtaatgtttgaagaggagttagtgaaatttaccttttgcttcaaatag
AAGTCGGCCAAAACCGCACCTATAATCTCAGCTACGCCGGACGACTGCGGGAGTTCAAGG
CTGCAGTGAGCTATTATCATTCACTGCATTCCATCCTGGGTGACAGACCAAGGCTCT
gtctctaaataaacaacaacaaactctccaattcatctgttctccatctccatcattgac
acctggactaggccctgattggtctcctgcagccacggttgctgccttcaattcattctc
ctcaccacggacacagatgttaatcaagaatgacaagcatggcatgtgttatcaagggat

Exon  3 +       8701       8824   0    Initial    124    70        Good
ttatatgaaataaattttgaaattgctgaagctcttgaaattggaaggtaggcagtagta
gtcttttcagtaataatgtgctcccatgcctctctgctattcataaaaggattggatgaa
acctccctcttttccctgctttgcttgtttcaggatataagtcaaagagtacagcagaaa
ATGTCTACTGAACGGACTTCTTGGACAAGCCTGTCCACCATTCAGAAAATAGCCCTGGGC
CTTGGGATCCCAGCCAGTGCAACAGTTGCCTATATCCTATACCGCAGGTATAGGGAAAGC
AGAG
gtacgtgaaccctatgactgtgtgtgtgaaaatgttcagacatgctcctgccttgttaaa
ttgaaaaaaactctttccttgccaggtattgtgtgtgttttgttttggggttttttgtgg
ggtttttttgagacagggtctcactctgtcacctagcctggcgtacagtggcacaatctt

Exon  4 +      10136      10242   1   Internal    107   100   Excellent
gatcctttgggaccttctaattcccattcagatgccacttttccttgttgttatggttga
gatcctcactttatctcttggatcagtgtctctttgacagccagattctggggaggactg
gtagttatactagctttgggtgttatctaagtctgatctgatgaacaatgatctgtgcag
AAGAGCGGCTGACATTTGTTGGGGAAGATGACATTGAGATAGAGATGCGGGTTCCCCAGG
AGGCTGTGAAACTCATCATTGGCCGGCAAGGAGCCAATATTAAACAG
gtaagtgtgtgagtaggcagtctgctttcccaaggattgattctgtttattgatttcttg
tttccttccactgaccccatatcacaaaacattcacatgctctgtgtgtgtgtgtatgtg
tgtgtgtatatataaaatatatatatatatattttttttttttgagatggagtttcgctc

Exon  5 +      11583      11756   0   Internal    174    92   Excellent
ggttgtatagatagtaactgaggttgtatataaagtaattgaggactggttgtatagata
gtattagctaattcctttggctaattctatctacctccagggtttgttttagagtgtctg
tagctgggctcaaatgggagctcttccagaatgtactgccaaatgtccttttctttgcag
CTGCGGAAACAGACAGGTGCTCGGATTGATGTGGACACAGAGGATGTAGGCGATGAGCGA
GTGCTGCTTATCAGTGGTTTTCCTGTTCAGGTGTGCAAGGCCAAAGCAGCAATCCATCAG
ATCCTGACAGAGAATACCCCAGTGTCTGAGCAGCTTTCAGTTCCCCAGAGATCT
gtgggcagaatcataggtaccactggatggcttcctctattgtttcctttattctttacc
tttgcccctctttcacaccttcccagggttttttctggcctagttccccttcaccatgtg
aggggaaaaaaagggacattgagaccagaggtttactgtttgtagaactggtggtaaaac

Exon  6 +      12717      13038   0   Internal    322    86        Good
tgtgacaaagaatcagaagggacattactactatcaagacttataaaaatctcaggaaca
cagaaggaagtggcagcagccaaggcaagtagctaatagacttgaattatacctgagcat
gagaagatccttttactctatcccaggtcagaatatcatcctttctcttgttttccacag
CATTTGATACTGGAGAAAGTTTCAGAAGATGAAGAACTTCGGAAGAGAATTGCTCATTCT
GCAGAAACCAGGGTCCCACGCAAACAGCCAATCAGTGTGAGAAGAGAAGACATGACAGAG
CCAGGTGGAGCTGGAGAGCCAGCATTATGGAAAAACACCAGTTCTAGCATGGAGCCGACT
GCACCCCTGGTGACTCCTCCACCCAAAGGAGGAGGCGACATGGCTGTGGTAGTGTCAAAG
GAAGGTTCCTGGGAGAAACCTAGTGATGACAGCTTTCAGAAGTCTGAAGCCCAGGCCATC
CCAGAGATGCCCATGTTTGAAA
gtatgtaacaaagagggagcccattaatcattgaagatagaaatactggcttagatattg
gagagattagaaggaatgccttctcagtctgagcagccagtataatatggctggggtcag
gacagaagattcggtaagatattttgaagatgggatggaggtagaatccacaccaacagt

Exon  7 +      14678      14757   1   Terminal     80    52    Marginal
tgatccacccaccttggcctcccaaagtgctgggattacaggcatgagccaccatgccca
gcctagacatactttatcaacaagtaaaattctcagccagattttatattgcctttttca
ttactgtttttaaaaatcatcactattgaaaaggctgtgagctttctcttctgtacatag
GTTTTGGCGTGGGCAAAGAGGACCTGGATTCCCAAGAAGCTCACAGACTTGTCCAGGGTC
ATGTAAAGAGTCAGTGGTAG
aatgggatctggaacaggtccatgtccgtcactgtccatgtaaagattgctgtccatata
cctttttactgatccatgctgtagctagcatatggaggtttaccttctgtataattggtg
accgatttgactatgtagcacatgacaaagaatgtaagctgttattactcagttacatgg

Exon  8 +      15082      15284   1   Internal    203   100   Excellent
acaaagaatgtaagctgttattactcagttacatggaaaggtacaaaggatagcttagta
tctttctttaggatattcttgtttgattcatccagttgcctctcctgccattttaaaatg
gtaacagccattggtatttgtacctctcactaccctggttagtctcttcattccaaccag
AGATGGGTCTGATGTGGCCACCATCCTTATCTCTGTGTTCAGTCCCCAGTCCTGACTTCA
GTTTTCATGCTGATGAGTACCTAGAAGTCTACGTTTCTGCTTCTGAGCACCCTAACCACT
TCTGGATCCAGATCGTTGGCTCCCGCAGCCTGCAATTGGATAAGCTTGTCAATGAGATGA
CCCAGCACTATGAGAATAGTGTG
gtgagttgccatagggacagggctggggtttaatgaaaagaaggcatatctttttcattg
tactcttcctttccctgtggagcaactacttttctttcttcctcctgcaattctgtttat
gagcctaccactttgtaactctctgcctttctcctcctccccacatacagcctgaagact

Exon  9 +      15455      15627   0   Internal    173   100   Excellent
gaatagtgtggtgagttgccatagggacagggctggggtttaatgaaaagaaggcatatc
tttttcattgtactcttcctttccctgtggagcaactacttttctttcttcctcctgcaa
ttctgtttatgagcctaccactttgtaactctctgcctttctcctcctccccacatacag
CCTGAAGACTTGACTGTGCATGTAGGAGACATTGTAGCAGCACCTTTACCTACAAATGGT
TCCTGGTATCGAGCCCGGGTCCTCGGCACCTTGGAGAATGGGAACTTGGACCTCTATTTT
GTTGACTTTGGAGATAATGGAGATTGCCCACTGAAGGACCTCAGGGCTCTCAG
gtcagtgctgaggtcagctcaatcccaactgctgactcagttctggccatagggtggtga
gctgttggcagttgtcagggggatttggaagggaacctgtttacagagagcagatggtta
tcgtctcatgttagttggttctttctgaaagcagcaatgtaagaagatgtttttggcccc

Exon 10 +      16154      16331   2   Internal    178    89        Good
ttctcacattcccaggctttttgaattctggggactcaggtgccttttcctcaccagcac
tagcagcagccagaaacttgcctggcagacccaacccaaccagagaagacacaggtgcct
tcctgagtagaaaagggtagttccaacttccctccagggtataagccccacccctatcag
CAGTAACCCCTACAATCTTTTGCCAGGTGACCAGTGGGAAGAGGAAGCTTTGGATGAGTT
TGATAGACTCACTCATTGTGCTGACTGGAAGCCTCTGGTAGCCAAGATCTCTAGCTATGT
CCAGACTGGGATCTCAACTTGGCCAAAGATCTACTTATATGATACTAGCAATGGGAAG
gtaagactggcattcactcactgcttgccatatcttcagtatatttatagcctaatttac
tttttcttcctcagaaacccttatctgatattactcttactgtaagatccttctcaccat
ctcaccaaaggaatgtctttaaagtatcagtccttctgccttgtttcctcaaatttgccc

Exon 11 +      16557      16658   0   Internal    102   100   Excellent
tatagcctaatttactttttcttcctcagaaacccttatctgatattactcttactgtaa
gatccttctcaccatctcaccaaaggaatgtctttaaagtatcagtccttctgccttgtt
tcctcaaatttgcccttgcttactgagagaacatcattcccttttcatttttcttctcag
AAACTTGATATTGGGCTAGAATTAGTACACAAAGGATACGCAATTGAGCTTCCTGAAGAC
ATAGAAGAAAACAGAGCTGTCCCAGACATGTTGAAGGACATG
gtgagctattgtagttatatagggtgctgcttccaggcaaatctagcacatagacactaa
gggcttctagtcctgatactgtgttagctttcctaaggactttgagctcctccagtagtt
gaccaaaggagcattttgtccctcttggtagccaaatgcaactgccttaaccaggtccta

Exon 12 +      17219      17271   1   Terminal     53    85        Good
gcatctttggagattaacttttctcattcagtctttccagagtagggaggttaattgaag
gcttggttcctagtcaggtcattgagtaccaagaggtccatttttcttttgagcctcgct
ggcattgcctgctagaatagggcagtgtctaactttctccttcttatttatcttcaatag
AAGCTGCTTCCATGTCTGGTGATGATAACCTTGAAGATGACTACTTACTCTGA
agtctgggcttcagtttgctcagccatctgctttgctgtgtgagtgcagctatcatctat
ctgtagcaacaggaaagtaatgagggcgacagtggggcacttgctttgattccctctttc
ccatgccctgtcttaatatacttctctgcagctgctttcctgcagcttaacttgctctca

Exon 13 +      21161      21355   0   Terminal    195    85        Good
acatagtaagctctgaaatagtatctatcacttatgaatggttattcaccatcccttata
tccaacagagtttgagctccttgaggcaagaggctatagtttctgtaacatatgctccag
gcatccggttaaatatgtccccgttcccttggccttatgtctgaccctttcacattgtag
GTGCTCCATATGTTTGAGATCCATTTTGTCCTGCTGGCCACATCCCTTGAATGGATTCTG
TGTAATTTCACCAGTGCTCCTTCAGTCTGGCCCCTAACACCACCTGCAGGGGCTTCCTCA
GAGTCCAGTTGTAACTTGATGGAACAAGTTACAACTTCCCACCTTCGTGGTAGGTGGGAA
GAAAAGAATCCCTGA
a
--------------------------------------------------------------------------------