--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (14287 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (5 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1970       2124   0    Initial    155    88        Good
gggtgaagatggtaggagagtctggagaacgggtctgctctggtggcttatggactactc
tgtggaaggggctgctgttctggtagcatcgaaggagctttctacgggagcgctgtcaag
aggattttggtgaatttgacgtacttggtttgataactcactttgcttttttctctaaag
ATGAGGCTGCTGTCATTTGTGGTGTTGGCTCTATTTGCTGTCACTCAAGCAGAGGAAGGA
GCCAGGCTTTTGGCTTCCAAATCACTGCTGAACAGATACGCCGTGGAGGGACGAGACCTG
ACCTTGCAGTACAACATCTACAATGTTGGCTCAAG
gtaactcgaggccctagagttacagattaagcctatttctggattcttagttttcagatg
ggaatagggagcatattggtgggtagtggtttctctttgggacacttccagcatcagata
tattgagtgaatgaatacacttcgggatctacttttggaaaggaggacattcttacctaa

Exon  2 +       3769       3885   2   Internal    117    95   Excellent
tttagtagagacagggtttcaccatgttggccaggctggtctcgaactcctgacctcagg
tgatctgcccacctcggcctcccaaaagtgctgggattacaggcgtgagccacggcgccc
ggcctgctttaattttatatccattacttactaaccctttttgtttcatccattttctag
TGCTGCATTAGACGTGGAACTATCTGATGATTCCTTCCCTCCAGAAGACTTTGGCATTGT
GTCTGGAATGCTCAATGTCAAATGGGACCGGATTGCCCCGTATCCTCTTGGCACTTG
gtgatgaagggtcggggggcagggagagccttgcctgcaaagcagcaggggtacttcaaa
taggctggatatgtgtggctgtcctcctgtcatctctctggataagatggagcaagagag
gttggtgtaaattgtgtgagcatgatttagagtagacatgaagaaggaggatactgaagt

Exon  3 +       7068       7176   2   Internal    109    94   Excellent
acaggcgtgagccaccatgcccggcaaagaagcctatattttttcattcctgcagaatat
tgccggcatgagatcagcatgtattggcaaatgttttgtaagtggtgcatttagtccaca
ggttgaaaggctgctacaactttagcttcatctctttccgttccttaactcttgagccag
TGCTAGCAATGTCTCCCACACTGTGGTCCTGCGCCCTCTCAAGGCTGGTTATTTCAACTT
CACCTCGGCAACAATTACTTACCTGGCCCAGGAGGATGGGCCCGTTGTG
gtgagttgcccaaacccttagctggatggaatttggatctgccttcccttaaaatctctt
gtggtgggggtaagagggggatgaagagaggttgattaatagataccaaaatacagttag
gactgggcgcagtggctcacacctgtaatctagcatttttggaggccgaggtgggcagat

Exon  4 +      10855      10932   0    Initial     78    66    Marginal
tggtctagtctaggaaagaattttttgaagatgagcctgaagtactgaatgctggaattc
attcagtgaataagtatgatgttccagattatgtgctcattctgtgctctgctttgggga
cacagtgatgaataagacacagtcccttccattaaagatcttacaggctggcgaggcacc
ATGGCTCATGCCTGTAATGCCAGTGCTTTGGGAGGCAGAGGCGAGAGGACCACTTGCGGC
CAAGAGTTTGAGGCTGCA
gtgagccatgatcacaccactgcactctagcctgggtgacacagcaaaaccctgcctctg
aaaataacaagatcttacgagctcatagaggactcaaaatagtaaatggggaggctgagg
caggggaattgcttgagcccgggatgcggaggttgcagtgagccaagatcgagccactgc

Exon  5 +      12487      12597   0   Terminal    111    81        Good
ctgcataccagcctaggtgacagggcgagactccgtctcaaaaaaaaaaactaagacttt
gtatcaaaaataaataaatttgggctagactgctccctttctcattggactcatattttc
cctggcttctcctgtgccctaatccagacttctaagcaaggtctttgttttcctttacag
CTGGACTGGGCAGCCTTTGGGGTCATGACCCTTCCCTCCATCGGCATCCCCCTGCTATTG
TGGTACTCCAGCAAGAGGAAATATGACACTCCCAAAACGAAGAAGAACTGA
ttggggcttccacagccctcctctcccaagaaatccaggctcctctcccaagaaatccag
gtgctttccagactccaaagggtatcttaaatgcaatctcttctctcttagcccttggcc
actttctcctggatcctgccctgctctcagccatagtgaaggaccagccctaggagtctg

--------------------------------------------------------------------------------