--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (86550 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (25 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        548        724   0   Terminal    177    69    Marginal
gctctcactgcagagttaaggcactttggtaaaataaatgtgcatctaggaaatgatcat
gtgtacagtaggcattggatcattctcttgcccctcttttacctgcccctaatgcctaag
ctacattcgaagtcctggaaaacctgtaagtaattccgcctttggcctacctcccctcag
AAGAGGAAGGTGAGAGAGGCCAAACGTATGGAAAGACTATTCTTCAGGCTTGCAGGAGTC
ACGGATGTCCTGATGTCTGTCTCCGTAGGATGTGGCCCACATCAGTTCGCATTCACCTTC
TTGCAGCAAGGCAGCTGCTTAGCAGACAATGGGCGCTCCAGTGAGCGGGGTTTATAA
aaacccgaagccccggttcatgatggagcccccttttccagctgagcaagctcagggatt
tcctgggtaggtttttccaggctctgcctcaccgaaggaattttaggagtgtctctgggg
aacaggagggacgtaacccagccccaacttgagggcgctagaggtgcggcaaggggtcgc

Exon  2 +       1260       1424   0    Initial    165    76        Good
gacgcgagccaatgaggagtgggccggggaagagggacaggcggccagcctatggggcgg
agaggcccggccgcgcgtatccaaggagcgccgcgctcggctcgggggtgtggcgcgcgc
cggcgggggtgggcgggcgcgccgggcggcaggtgtcggcgtcggcggcattcggcggcg
ATGGAGCGGCCCTGGGGAGCTGCGGACGGCCTCTCGCGCTGGCCCCATGGCCTCGGCCTC
CTCCTCCTCCTGCAGCTGCTGCCGCCGTCGACCCTCAGCCAGGACCGGCTGGACGCGCCG
CCGCCGCCCGCTGCGCCGCTGCCGCGCTGGTCTGGCCCCATCGGG
gtgagctgggggctgcgggcggccgcagccgggggcgcgtttccccgcggcggccgttgg
cgtcgcagcgcgccgggcgaggacgaggagtgcggccgggtccgggacttcgtcgccaag
ctggccaacaacacgcaccaggtgagcgggcgccgggcccgggagccgctcgggtgcgag

Exon  3 +       9245       9377   0   Internal    133    92   Excellent
gtcaacagaaactttattttagggtgaggtagttgatggggagtatgactaaggtttcca
ggaaaacatatagggaagttaaaaaaaagatagctcttttgtgggggatggaaagagagg
aggggcgtgggtagtgagtttggcaaaaggacttacttgtgaaagagagagttttaacag
ATAGTGCTAGACATGAGGCTAGAGCTGGAGGAACCAGAGGTAGAAATGGGGAGCCAAGAA
GAGTTCCCCTTTCAGAGGCCGGCCATTGCTTTGGTCTTGGATGTGAAGGTCCCAGAGGAA
AGCAGAACAGAAG
gtgaggcagaccatcctttatacttgaagtgctaacgtttccaaaaagcactcctaaact
tctggacctggttgaagaagaatgtgagccaaggcatgaggaagccaggagctgtaagac
agtgatgcctatgaacagatttttctgaacatttgtgaacaaggataaggttgaactctt

Exon  4 +      17292      17392   2   Internal    101    53    Marginal
atagttttatttttaaaatgatttctgccaattggaggtgggatgagagtaatttatgca
ctctagaaaaactataaagaagagtgcacccctatcaattctataataccacttaaagac
agttgctattgatattttaaagggtatccttccagataccttttttttttcttttttaag
GGACAATCTTGCTCTGTCATCCAGACTAGAGTGCAGTGGCACAATCATGGCTGACTGTAG
CCTTGACCTCCTGGGCTCAAACAGTGTATCTGGGACGACAG
gtgcttgccaccatgcctggctagtttttattgttgttgttattgttggttttttggagg
caaagtctcactatgtttcccaggctggtctcaaactcctgagcttaagcaattgttctg
cctcatcctcccaaagtactaggattataggtgtgagccactgtgcccggcccctgataa

Exon  5 +      21479      21586   2   Internal    108    72        Good
tctttgaaaattttcaagatacttgcatattatcttcctgtgtgttctacctgcaccgct
gccttctctcattgccttgctcttgcttatatctgcctcccaactctgtaaactctgctt
aaatctcagtagtcagacctttatttcttcacttgaaatttgaatttctcttctatatag
ACTACCCCTGCTCAGTGCCTCTAAACACTTCGACGTGTTCAGGGCATCTTTACCAATGTT
TAGCTACGTGAAGTTAATGGTAACTACAATGGGAAAGAGAGGAGTAAG
gtcaccatcatgtgtgaacatctaagaacacataccagtgtataacagtgtcttggctgg
ctggaagagcataggaataaacgctattcagccattatttactgagacagcagtaaccgt
gttagaaggaagattacatacagatcaataatgttagttcaggacaaacagctatcatga

Exon  6 +      27762      27827   0    Initial     66    59    Marginal
attggctcaagactgatatcttacagcctgatgaagacaaccacgaattccagtgccata
actgatggactttttcttttctcttagttatgacaaggaccttccttggaaagataacct
gtgtttagatgactgtgatcttagcccttgtgatctgcctggtgcttgtggtagctctgg
ATGTTCCTGTTTTTCCTGAAGGACCTCATTGATGTCATTTCAGACACTATCCTCACTCAA
GAGAAT
gtgaggttttgctatgtgtgaaatatcatataagacacactgctatgtcagtttttaagc
ctctggtttcagaagctctggcagccctactttttctcagatgcctggcaagcctgcatg
tctgaatagcccttctttcctgcagaggctgtgagaagctctgccgagcatttgagagtt

Exon  7 +      39938      40045   0    Initial    108    42    Marginal
tgccgtacactgaatgtttatgttccctctgaactcatatgttgaaattttaacccctag
tgcgatggtattaggaggtgggaccttcggtaagtgattaggtcataagggcagaacctt
caccagtgggattagtccccttataagagagaccccgagagctcccttgccccttctgtc
ATGTACGGTTACAGTGACAAGAGGGTAATCTGTGAAGCAGGAAGCAGACCCTCACCAGAC
AGCACATCTGCTGGCACCTTCATCTTGGACTTCTCAGCCTCCAGAACA
gtgagaaatgaatttctgctgtttataagccacccagtttataatattcttttatagcag
ccctagctaaaataagctctattccaaatatatttgtattttagcattattttcttgagt
tataaacatgtgcatgtttacaccgtggatacatgcaaaaatgatcatttatttttggta

Exon  8 +      43683      43785   2   Internal    103   100   Excellent
ggggcgggtggaatgttcttcggactcaccagggcacctctggagctaggaatgtggcta
ttcagggtgagccgagtctctcagcatgattggtggaaagggagaatgaaagctgagtag
gaactcagtaatatccatgaccactgcaccctaaatttgccctttttttcttcctctcag
TGAGGATTATGGGAAGAACTTTAAGGATATTACAGATCTCATCAATAACACCTTTATTCG
GACTGAATTTGGCATGGCTATTGGTCCTGAGAACTCTGGAAAG
gtgagactcattcttgtatacataaagcttgtgcttgataccacatgcagagctgtcaga
tattagtattggcatggtccagtgattcacagtaatgtattttagtttagtattgctata
tttatattttaaaattaaacacaattttttaagggtctcactctgtctcccaggctggag

Exon  9 +      44621      44785   0   Internal    165    82        Good
ttatttttttataagaataagacccaaggggtagagtggaacaactaatcagtttttata
actcttcttatttctagaactaaaatttcttaactaatgtctggtgaaaatggtgtaaga
actcctgtgcttgcatagatagtatcataccctgaatcagatctttcctcttcctatcag
GTGGTGTTAACAGCAGAGGTGTCTGGAGGAAGTCGTGGAGGAAGAATCTTTAGATCATCA
GATTTTGCGAAGAATTTTGTGCAAACAGATCTCCCTTTTCATCCTCTCACTCAGATGATG
TATAGCCCTCAGAATTCTGATTATCTTTTAGCTCTCAGCACTGAA
gtaagtccagttgaggaacatggtttgccttttgcattttatagtctcaaatgtactgtc
ttagaaggatcctttaggaaatgcttttaatattggacttctttcaagtctccttatggc
atgaagtatgtatttttttgacgttttttcctatttggtaaaggacacgatttccacatg

Exon 10 +      47905      48063   0   Terminal    159    56    Marginal
gcacctgtcttcttcaggacaccatctctgatgcaatgttcctcctctcctcacttctat
actagaccatattttataactctgcatagtgttgaactttcttcttatctatgcgccttg
ttaaactgtgagccccttctctcagcagggagtgtgtcttattcatctttgtatccccag
TGCAACATCTGGTACAGTGCCTGGCACATAATAGGCACTTCATACGCATTTGTTATTCTG
AACTTCCAAGACCCCAAAAGGGCCCAGATAAACTACGTGTGTGTCTGTGGAGCTCGGGCA
GCTCTGATGGAGCTTCAGTATGTGTTTTTCCTGTCCTGA
atgattggatatgaaatattaaaggtcatacaagcaactacacaggataaagctagaatt
ttgataagtcatttataatctttcagaatggcctgtgggtgtccaagaattttgggggaa
aatgggaagaaatccacaaagcagtatgtttggccaaatggtgagtaacagaagactcca

Exon 11 +      48150      48223   0   Internal     74    81        Good
ccaagaccccaaaagggcccagataaactacgtgtgtgtctgtggagctcgggcagctct
gatggagcttcagtatgtgtttttcctgtcctgaatgattggatatgaaatattaaaggt
catacaagcaactacacaggataaagctagaattttgataagtcatttataatctttcag
AATGGCCTGTGGGTGTCCAAGAATTTTGGGGGAAAATGGGAAGAAATCCACAAAGCAGTA
TGTTTGGCCAAATG
gtgagtaacagaagactccatctgtgcagagccctaaacccttcctgatagcgctgccaa
aaatcacatgaataaatattgagcacttactgtgtgccaagtactcttcagggtgccata
agagatattggagaggggtgtgacacaggccttgacctggaggagcttctcattctgctg

Exon 12 +      51204      51344   0    Initial    141    74        Good
ttgaactagattctgaagggaaacagcaaagtatagtacctgccctgaagaagctaattt
atatagtaggaaaggtaaggcatatactatgcaagtaaaataaaaaacaggcaaatgcat
gccaagtggctgtgcagatggtacagtgctctaaaacagagtttctcaacctcagcacta
ATGACATTTTGGATCAAAGAATTCTTTATTGTGGAGGACCGTCCTGTGCATCATAAAATG
TGTAGCAACATCCCTGGCCTCTACCCGGTAGATGCCAATAACACCTCCGCCACCCACCCC
TCAGTTGTGATGATCAAAAAT
gtcagaggcaaatgttgagagggtgagtagaccagcatgactgcctgaaagagttcacgt
aaagaagtggtggactgtagacaacacatgggccgggcagtggggagcttgacaggcaga
gctgtgaaggaccagggctcagcgcctgagaagtggtgcttgtcagtgcctgtgaatgaa

Exon 13 +      56994      57138   0   Internal    145    90   Excellent
ctagaactttgctaggggctagaaattgctttggtaattggtactatgacctttcattca
tagcaatcgtacccagtagagaaatggataatagtagttatttaaaacattcttgttcat
gtccctgcccatggcatcttggcagaaaattagaaagataaatattgacatctgttctag
GATACAACAAGAAGGATCCACGTTTCAACAGATCAAGGGGACACATGGAGCATGGCCCAG
CTCCCCTCCGTGGGACAGGAACAGTTCTATTCTATTCTGGCAGCAAATGATGACATGGTA
TTCATGCATGTAGATGAACCTGGAG
gtaagagctttttagtggcttacccttaaaagcatagagatgtaagctttgagcagcttt
tatttttacatgtcgagttttcctcttacccctagaaatttattagtgccctactgattt
ttctgtcctagagatcatctgtagcccctgttaaaaatgccacttgttttggtagcttgt

Exon 14 +      58303      58428   1   Internal    126    97   Excellent
ttgattaattctcaggtctgagtcttcatcatgaagagacacaattggctactgtgtttg
gtcaggcaggtaatcgtgtgtggttagactattgtttttctctttggttccacccaagac
ttagtatttttgtttgtttgcctatttcagacactgggtttggcacaatctttacctcag
ATGATCGAGGCATTGTCTATTCCAAGTCTTTGGACCGACATCTCTACACTACCACAGGCG
GAGAGACGGACTTTACCAACGTGACCTCCCTCCGCGGCGTCTACATAACAAGCGTGCTCT
CCGAAG
gtgagtctcggcatcgcagtggtgtactgtgccttcagctgcatgtggtaggatttgagg
cttcggggaacctgtcccctagtaatgttgcttgccaagccaacaagcctacccatgtac
atttttttgtttccttttttttttttattgtggcaatatgtctaacaaaatttgcagttt

Exon 15 +      60522      60563   0    Initial     42    58    Marginal
caggaggacagtccagcagggacagaccaaacccatgcaaattcaggctccctattttaa
ataagttatgataaatagaactaggagtgaggagagcaacaacaagtagaaaaaaagatg
ttttgaatctatgttgtttaggtaataaagtgagtcttctatattgggagatgtaggcct
ATGAGAATAAGCCTGAATTTGACCCACTTCCTGCTCTTCTTG
gtaagggtgcatagcagtagccagccagggttcttcttgtgttctactcaatggctctac
agagctcacctttccttaggcccagttatacaaataaacacattagtctcaagtacaaag
actcttaaagtgtcattttatttatatatttatttttcggtaggaggtaggggctgtttt

Exon 16 +      62806      62912   1   Internal    107    75        Good
ctcaaatatcatatttaaagtgctgctccgttaccaacaatgagccgttttgtgaggtgt
tacaagcttgtcggactccaggtgctatacggtctcaggagagagtcatgcagtgataaa
gtgaatctaacctaggtacttccagtgtatcagacttaatgttgttctcttcccattcag
ATAATTCTATCCAGACCATGATCACTTTTGACCAAGGAGGAAGGTGGACGCACCTGAGGA
AGCCTGAAAACAGTGAATGTGATGCTACAGCAAAAAACAAGAATGAG
gtttgtttactctaatgtgtgcagagcacagcagcctttccattgtgctctgatcagtgc
cagccttttggatgatgaagtttcatacttgattagggtcctcagcataaggtggaaagt
ttggagatgagagtaatgaaattaacttagaatttcggaagtaagaactgaggaaaggtc

Exon 17 +      69991      70076   0   Internal     86    55    Marginal
gcagagcttgcagtgagctgagatggcaccaccgcactccagcctgggtggcagagcgac
actccgtctcaaaaataaataaataaatatagccacccctgctctcttttggctaccatt
tgagtggaatatcttttttttatctctacttttagcctatgtgtcctcttacacacatag
GCCTTTACAGATGGCTTCAGCAGGGGAAGCCCTTACCAGGTAGCTCATCCAGAGATTCTT
GGGGGGGCAACTGACAGGTTCTGCAG
gtaggtgggcctggtgccttggtctttgggggtagcttggaggctgggtcctctgcggca
ggcctggcagtggaatccactagggtggaccttttaagtgggtcttcaggtgaaacacct
ggagcccggtaagtagatctgcaggagccagcctggtgcaggggtgggccctaccctgag

Exon 18 +      71556      71653   2   Internal     98    85        Good
tgaatatacttaacactactgaactatacacctaaatagtaaataaatagttaagatagt
acttttacctaggtctgggttaacttaaagctttattggaagggttttgtgaaatgatta
aagaaattgtatctttatctttggttctaatctacgcttttgtttcttttcacagtgcag
CCTTCATATTCATGCTTCCTACAGCATCTCCCAGAAACTGAATGTTCCAATGGCCCCACT
CTCAGAGCCGAATGCCGTAGGCATTGTCATTGCTCATG
gtaaggaacctcccactcaccacctccaactggaacagtggctgagcacactgaaactca
gccaacaggctttgaacgctctgagaagaaacaatgtggatgcttttacattcctttggt
agaatttcttacattataacaacactttgggtttttcatcaacttttatcagagagagca

Exon 19 +      71992      72152   1   Internal    161   100   Excellent
tcaacttttatcagagagagcaacacaacttctccgaagtttttggtggttttctttcct
actaaaagaggcttgatgggaaataatcagaataaattcattcaacattattctctctgg
agtaaatgctctctgtttcattgcctatttgtgctaatgagatggtggattatattgcag
GTAGCGTGGGGGATGCCATCTCAGTGATGGTTCCAGATGTGTACATCTCAGATGATGGGG
GTTACTCCTGGACAAAGATGCTGGAAGGACCCCACTATTACACCATCCTGGATTCTGGAG
GCATCATTGTGGCCATTGAGCACAGCAGCCGTCCTATCAAT
gtgattaagtatgcatgaactcatctcacacacactgtctgcatagagggcaactggggg
aatgttcttcagtttattggggggatgttacagactataattcaaatttttgcatttgac
agaactatagataagattctagaaaggattgcttttaattggcaactcagattaaatggc

Exon 20 +      74063      74253   2   Internal    191    99   Excellent
gagactccatctcagaaaaaaaaaaaaaaaaaaaaaaagttaaaataattgtcagccaat
aagccaccacctaaatgtaaggggttttgtctggtttgggatcaaaaagccagagtggtt
ttctgaattcccagtacacattgatcctctgtcatgatctttctgtaattgtggtttcag
GTTCTCCACAGACGAAGGTCAATGCTGGCAAACCTACACGTTCACCAGGGACCCCATCTA
TTTCACTGGCCTAGCTTCAGAACCTGGAGCTAGGTCCATGAATATCAGCATTTGGGGCTT
CACAGAATCTTTCCTGACCAGCCAGTGGGTCTCCTACACCATTGATTTTAAAGATATCCT
TGAAAGGAACT
gtgagtgtctcctttgaccttttctaccagaaacttccaagtccattttcctaaataatc
aatatggtttaatttcttttagctggaatcagcagatgcatatgcatatgaaagaggatt
gacagatgttctgtgtgggtgattaagtaatggaatggcatcagaaaaacaacctcctcc

Exon 21 +      75962      76220   1   Internal    259    89        Good
caaatagggtttttcctaatcctcagatggatgttgagatggaaggaatactcttttggc
atgaggaaatgcgattgctagtaggctctagactagtgtaactttttgtttgcaattcca
aaatgaaggaataggttgagtcagacattcccactttccctctccttgttcttcctatag
CCTGGCAGCTGCCTCCCGTGGGTGGGTTCTGTGCTGTGTACTTTCCTGAACAGTGTGTCT
CTCCTTTAGGTGAAGAGAAGGACTATACCATATGGCTGGCACACTCCACAGACCCTGAAG
ATTATGAAGATGGCTGCATTTTGGGCTACAAAGAACAGTTTCTGCGGCTACGCAAGTCAT
CCGTGTGTCAGAATGGTCGAGACTATGTTGTGACCAAGCAGCCCTCCATCTGCCTCTGTT
CCCTGGAGGACTTTCTCTG
gtatcagcattcctcagatttctctgtctccctttccctgttggaggaggtgaaagacag
ttttcttatagggctaacaaatattgaaatccagccgggtgcggtggctcacacctgtaa
tcccagcactttgggatgccaaggcaggcagatcacttgaggccgggagttcgagaccag

Exon 22 +      78564      78710   0    Initial    147    56    Marginal
cattgaataccagctatgcgcaggtaatgaaaagtgataatggaaaatttgttgcaaaac
agaaggtgccaggtgccatggggatttagaaaaggaagagaacatttcatgtagagctga
aaggaagtgggtcaaagaaggccttgttgaggaggtggtatgagagctgagcgttgacaa
ATGGTAGGATTTGACCATGAGCATCTGGGAAGAAGCAGCTCATCAATGCCAGTGGACTGC
TGCAAGCAGAGACACCAACAGCATGATCAAGGAAGGGTGTCCTGGAAGATAGGCCATTGG
GGAAGTCACAGTAGTCATGATAAAGAA
gtaagtagggcccagaaggaggatcctcaggctaaattttccactgagatagtgggaagg
aaggtaatgtcatggacgaatacggaaatgataaggagagcctggcacaaaggagaaaac
atgatgtattttgaacatcttatttctttgaggttttgtcagcatatttaggtgggatat

Exon 23 +      81183      81299   2   Internal    117    84        Good
ctccgtgtctgttttcctaaatcgacctccttcagaggtgtcacaggacttcctgagcta
ctttctaacaacccaagactggaatgttaaccatccactaccccacataacccttcattg
ctagtcacttaacggtcttccagctgctttgaaaggtactttatttgctgactcttgcag
TGATTTTGGCTACTACCGTCCAGAAAATGACTCCAAGTGTGTGGAACAGCCAGAACTGAA
GGGCCACGACCTGGAGTTTTGTCTGTACGGAAGAGAAGAACACCTAACAACAAATGG
gtgaggtggccttttctcccttgtcacgatggatgaggtgttcttgttcagagtgaaagc
tgcttctctccacactgagatccaagccctactttagagcactatttttggcggggttgg
ggaggggcaggatatgaaggcctccttcaagggtcaactacaggaggtgagccatgagtg

Exon 24 +      82194      82302   2   Internal    109   100   Excellent
aggcctgaaactacacaaaatatcccccaaaacatccctgtggacattccccccaggcct
gaaacatgacgtaaggatgggaagcttttcggcagcttttcaaatcttgtttccaagaaa
taggcaggtacccaggaatacatccttatcttctgttaccaaatcttctttgcctggtag
GTACCGGAAAATTCCAGGGGACAAATGCCAGGGTGGGGTAAATCCAGTTCGAGAAGTAAA
AGACTTGAAAAAGAAATGCACAAGCAACTTTTTGAGTCCGGAAAAACAG
gtatgttaaaataggtctagttttcaggtacaaatgggattttgtgttctgctaagaaaa
atcaaagttaaagcatcaagagttttgttactgataaaaagtggtcaaactacttctctc
aggcttcccttatacaggaagctgttagcatgaaggatgggtcatgtaacccagtgataa

Exon 25 +      84768      84891   2   Internal    124    97   Excellent
ttcctgaaaaatcaggcccaaatcttctcatgtcgtacatttttcatatgtcaaccatgg
actgtgctttctgtgtctgtgatgcgttcctgagtgtataaaactgagaaagtccacagt
cctgtaagaagtgcacccctgctgtgtaccaccgagtgttaaggaggtttctgttcacag
GTTCCTGGTGCATCGATACTCTGTGCTGCAGCAGCATGCAGAGGCCAATGGTGTGGATGG
TGTGGATGCTTTGGACACAGCCTCCCACACTAATAAAAGTGGTTATCATGATGACTCAGA
TGAG
gtgaggctatttcttcttgaatggtagtacccccccccccaaaaaatacaagaaaataaa
gtctgtcttctattcatgatcaagatatgccagggccaaggcgacttaatgaccataaga
tttggcaagcccagaaactaggtgattgcttttgaaataggagtgttgtggtctgtcggt

--------------------------------------------------------------------------------