--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (7264 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (8 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        119        171   1   Internal     53    74        Good
gtgtctgctggcatttgccccgtgcatgtatagcttggtcttgatttgattggcacccct
acttgtaaccgcagaacatccccctttcccttcctgttctgcccccacttttgtctagAGCAGAAGGGACTTGGCTTTGGCCACTACCCATCCTTCCTGCTGCCACTGGAG
gtgggagccaggcactgatctgtctatgcagaaccatcccccgtaggatgaggcctgtcc
ttactcatttctcaagaaacaagatgcttccaaaaggtctgtcatcctccagttgaagtc
tgtgtgcctaccaagaatggccggaggactcgctgcttgacgggagggatgctccagctt

Exon  2 +       1407       2073   0    Initial    667    70        Good
gctctccgcccgtgtggagtggtgggggcctgggtgggaatgggcgtgtgccagcgcacg
cgcgctccctggaaggagaagtctcagctagaacgagcggccctaggttttcggaaggga
ggatcagggatgtttgcgagcggctggaaccagacggtgccgatagaggaagcgggctcc
ATGGCTGCCCTCCTGCTGCTGCCCCTGCTGCTGTTGCTACCGCTGCTGCTGCTGAAGCTA
CACCTCTGGCCGCAGTTGCGCTGGCTTCCGGCGGACTTGGCCTTTGCGGTGCGAGCTCTG
TGCTGCAAAAGGGCTCTTCGAGCTCGCGCCCTGGCCGCGGCTGCCGCCGACCCGGAAGGT
CCCGAGGGGGGCTGCAGCCTGGCCTGGCGCCTCGCGGAACTGGCCCAGCAGCGCGCCGCG
CACACCTTTCTCATTCACGGCTCGCGGCGCTTTAGCTACTCAGAGGCGGAGCGCGAGAGT
AACAGGGCTGCACGCGCCTTCCTACGTGCGCTAGGCTGGGACTGGGGACCCGACGGCGGC
GACAGCGGCGAGGGGAGCGCTGGAGAAGGCGAGCGGGCAGCGCCGGGAGCCGGAGATGCA
GCGGCCGGAAGCGGCGCGGAGTTTGCCGGAGGGGACGGTGCCGCCAGAGGTGGAGGAGCC
GCCGCCCCTCTGTCACCTGGAGCAACTGTGGCGCTGCTCCTCCCCGCTGGCCCAGAGTTT
CTGTGGCTCTGGTTCGGGCTGGCCAAGGCCGGCCTGCGCACTGCCTTTGTGCCCACCGCC
CTGCGCCGGGGCCCCCTGCTGCACTGCCTCCGCAGCTGCGGCGCGCGCGCGCTGGTGCTG
GCGCCAG
gtaaggctggagctccgaactgactaaggcggggccagccacagaagggggcgtgtcgga
gaccacagaaaggcttggtctcatccctgggcctgggaagaagccgactatcccttgggg
ttcgaaagtgggtggagataggagtctccgggtttgagaagggatgaggctgaatctttg

Exon  3 +       2971       3129   1   Internal    159   100   Excellent
ctcctactcatttctccacctcccccagaccacccatatttccaggacagcctggtctcg
gtcctcagcttctgtcctgcctccgcctctttctgtgggaaacccagcgggggtgcaaac
agataggtagagcttggagtttgcccttcccctgatcgtcccataactgccaccccacag
GCCTCCCCAAGGCTGCTCGGATCAGTCATCTGAAGATCCTGCAATGCCAGGGCTTCTATC
AGCTGTGTGGTGTCCACCAGGAAGATGTGATCTACCTCGCCCTCCCACTCTACCACATGT
CCGGTTCCCTGCTGGGCATCGTGGGCTGCATGGGCATTG
gtcagtctccccaaccccaccttcattaattcatccagtagacatttattaagcacgtac
tatggtgtgagtcctccagggtagataatctagaggacggatggggcagagccctactca
ccaggagctctgtacaatagggcaatgtcacctgcctagacctacagactgaggaacggt

Exon  4 +       3670       3794   1   Internal    125   100   Excellent
gggacaggggccgggggaggggaaagagggccagcacggcttcctgacggtgtgactccc
acagtgggcccttcccagggaaagactacagtgatggctggggtctggaaagaggggctt
gggctccccactctgctcctaatcttacctcccttcttcccccctgcccacttctggcag
GGGCCACAGTGGTGCTGAAATCCAAGTTCTCGGCTGGTCAGTTCTGGGAAGATTGCCAGC
AGCACAGGGTGACGGTGTTCCAGTACATTGGGGAGCTGTGCCGATACCTTGTCAACCAGC
CCCCG
gtgcgtgggcacagatcctgggcagagctgctgacacagggctagctcacggggagcagg
acagttgacaggagacagggagttggagggagaagcagcaagaagaaaatggcagtgtaa
gataaggagccagagatggcctaggccatctgatgcttacggcctctgaaggaggtcaca

Exon  5 +       4070       4244   0   Internal    175    74        Good
cagcaagaagaaaatggcagtgtaagataaggagccagagatggcctaggccatctgatg
cttacggcctctgaaggaggtcacagtaggagggggttctggggaatggggaacaggaat
tcacttccgggagcgggcatcttgatgctgaagctccggcccctctcccactcatctcag
AGCAAGGCAGAACGTGGCCATAAGGTCCGGCTGGCAGTGGGCAGCGGGCTGCGCCCAGAT
ACCTGGGAGCGTTTTGTGCGGCGCTTCGGGCCCCTGCAGGTGCTGGAGACATATGGACTG
ACAGAGGGCAACGTGGCCACCATCAACTACACAGGACAGCGGGGCGCTGTGGGGC
gtgcttcctggctttacaaggtgaggggcagagaggaaactgaaaacccgtggaacagca
gagggctggcaggagagggggctcatgtgactgcaatgatccagtacccaggtctccctt
tccccagcatatcttccccttctccttgattcgctatgatgtcaccacaggagagccaat

Exon  6 +       4596       4794   1   Internal    199    81        Good
agagccaattcgggacccccaggggcactgtatggccacatctccaggttggtggtgttc
tggtggggtgggcggggtgctgaagctggcacaggaggactggaattggagactggggtg
gatgggggcagaaggctctgggaaaggtgacaccactcctgaccctggtgactctgccag
GTGAGCCAGGGCTGCTGGTGGCCCCGGTAAGCCAGCAGTCCCCATTCCTGGGCTATGCTG
GCGGGCCAGAGCTGGCCCAGGGGAAGTTGCTAAAGGATGTCTTCCGGCCTGGGGATGTTT
TCTTCAACACTGGGGACCTGCTGGTCTGCGATGACCAAGGTTTTCTCCGCTTCCATGATC
GTACTGGAGACACCTTCAG
gtatctgtccataactggtttttcatcctggacatctgatctctgtgatccaaagcttct
gaacctcaactctctaatctgccacctcaacctgggtcctaagctaatctctcattctca
gatctcaccatttcatccctgtgacactgacctctgacctcatctccccaccaagcccat

Exon  7 +       5023       5120   2   Internal     98    98   Excellent
tccaaagcttctgaacctcaactctctaatctgccacctcaacctgggtcctaagctaat
ctctcattctcagatctcaccatttcatccctgtgacactgacctctgacctcatctccc
caccaagcccataaggccctgacccctgactcccagtttcagatctctgctctctgacag
GTGGAAGGGGGAGAATGTGGCCACAACCGAGGTGGCAGAGGTCTTCGAGGCCCTAGATTT
TCTTCAGGAGGTGAACGTCTATGGAGTCACTGTGCCAG
gtgcctaggcatggaaggtgggggaggcacccagccaccaccccgaattggtagtacttg
ggcgcagggagcacgaggccttcgtggtggtcagccatggaggggcttactctgtctccc
acacccaccagggcatgaaggcagggctggaatggcagccctagttctgcgtccccccca

Exon  8 +       5754       5911   1   Terminal    158    95   Excellent
cttctggcctggctctttctcctccctgtcacctcctcccctaaaccttgacctcacact
ccctttcccaagacttgctccttaacaaaattcaggcaactcccctgaaccacgtgggca
gagtccccttccctccaaatccctgaccctcctgtccccaggagtctttggccaccacag
AGACCTTCAAACAGCAGAAAGTTCGGATGGCAAATGAGGGCTTCGACCCCAGCACCCTGT
CTGACCCACTGTACGTTCTGGACCAGGCTGTAGGTGCCTACCTGCCCCTCACAACTGCCC
GGTACAGCGCCCTCCTGGCAGGAAACCTTCGAATCTGA
gaacttccacacctgaggcacctgagagaggaactctgtggggtgggggccgttgcaggt
gtactgggctgtcagggatcttttctataccagaactgcggtcactattttgtaataaat
gtggctggagctgatccagctgtctctgacctacagtatctgtcattatctctctgtgga

--------------------------------------------------------------------------------