--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (12966 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (5 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1917       2005   1   Internal     89   100   Excellent
atgccgccttggctacttaacctcatgcctgagaaactcccctgctgcccttctgcgttt
ttcctgtcgttaagactgtcccagccctccagatcccctgagcctgggaggaggggtggg
aggcagagacagacatagttcctctctgagaaaccccggcagccctctttgtgctcacag
GGAGTCACGAAGCCCCCATCCCAACCTTCAGCACCTTCCAGATCACAGACATGACCCGCA
GGAGCTGCCAGAACCTGGGCTACACTGCG
gtgagtggaaacctggggcggcagcgtggtgcagctccctcatctctcccaccctcccat
ggggaaggacttgcagatggacaaaggccactccaagagaaggcaggaatgatccgggtc
tgccaacgggctggggcacagagagagagaacgaaaatgaggagtacctccttcatgcgc

Exon  2 +       2790       2974   0   Internal    185    99   Excellent
acagctggagctgaagaagggatttaagttagactttaggaaggactttctgggcaattg
taccctaaaatagacaggagaggctgggtatgaggaaaagaaggtggcaggtggatcaaa
gtcaggagaaggcccactcatcatgctgcttccccctccttgaactcttccctgatccag
GCATCTCCCCAGGCCCCGGAGGCTGCCTCCAACACAGGGAATGCTGAGAGGGCAGAGGAG
GTGCCTGGAGAAGGAAGCCTGTTCCTGCAGGCCGAGACCCGGGCTTGGTTCCAGAAGACC
CAGGCCCACTGGCTCCTGCAGCACGGGGCAGCCCCTGCCTGGTTCCATGGCTTCATCACC
CGGAG
gtgagtcatggaggaggaaattggcccagacaggggcagggcaagtcctgggtctgggtc
ctgccacctgccaggaatagatgaaggctcccacttctaccagtctggagtagatggagg
cgcccactccaggctcccactcccagagttttcctagcctttcactgaggcatctctcca

Exon  3 +       3717       3806   2   Internal     90   100   Excellent
aatccctgcagcgggagagcagcgcccacgtgctctctctccccatctccgccctagcct
ttctctagccgctccagcatgcttgcttgggggtaggggttcctcgtgagagccggggag
acagaggcgaggctggaagtgtcagagcagggttcggccccctctctccgtcacccacag
GGAGGCAGAGAGGCTGCTGGAGCCCAAGCCTCAGGGGTGCTACTTGGTGCGGTTCAGCGA
GAGCGCGGTGACCTTCGTGCTGACTTACAG
gtgaggggcgaggccccgcgccgggcgacacaaggcggggctcgggaggggcggggcttg
ggtctgatcccgtgaggagccgggctcttagctcattccccgggctgctgaaggtgggga
tcacgcctctcgctggtgaccctggccgaggagcgggagatagtctgatccctaacggcg

Exon  4 +       4037       4163   2   Internal    127    94   Excellent
gcggggcttgggtctgatcccgtgaggagccgggctcttagctcattccccgggctgctg
aaggtggggatcacgcctctcgctggtgaccctggccgaggagcgggagatagtctgatc
cctaacggcgccctccaggagccggacttgctgccgccacttcctgctggcccagctcag
GGACGGGCGCCACGTGGTGCTGGGCGAGGACAGCGCCCACGCGCGGCTGCAGGACCTGCT
GCTGCACTACACCGCGCACCCGCTCAGCCCCTACGGGGAGACGCTCACCGAGCCCCTCGC
CCGACAG
gtacgcgccccagaccctgaccagagagcccagggtctcgggccagcgcccctcccgctc
agagcccaggcgcaggacgcggcaccaggcactttctcatcccgaaacaccactcgggca
tgcctcccttacccaggcatcttcatcttcatgggagggtggcaggcccttcgagaaata

Exon  5 +       8521       8808   0   Internal    288    71        Good
ggagaaggaggtattgggctgcaggggctgagggagtgggaggacaggcctgcgaggggg
tgcaggcagcggggaggaggaggggcctagcgggggcagaggctcaggctgggagttagg
ctggggctttaaccctgcctccctcaccccactcctccctggcctcaccttctctcccag
CCCTCCCAGCTGCTCAGGCCCAAGCCTCCCATCCCCGCCAAACCTCAGCTGCCCCCAGAA
GTCTACACAATCCCTGTTCCACGACACCGCCCGGCCCCACGCCCCAAGCCCTCCAATCCT
ATCTACAATGAGCCTGATGAACCCATAGCTTTCTATGCCATGGGCCGGGGCAGCCCTGGG
GAAGCCCCCAGCAACATCTATGTGGAAGTGGAAGATGAGGGCCTACCCGCCACCCTTGGG
CACCCTGTCCTACGGAAGAGCTGGTCCAGGCCTGTCCCAGGAGGCCAG
gtaaatgggtatgcagggaaaggtaggtgcaagaaggtctccctgcaggtagatggggga
aggtgaagaaggtgttcagagtggatgcctggggcagggtaaggggcagaggtgtgaggt
gatgtgggaagaacagaatgatccaggcaccagcctcccttctccaggcccagaggctgc

--------------------------------------------------------------------------------